Informacije

Kada se mjeri dužina telomera, da li se metoda izvodi na kolekciji ćelija koja daje prosjek?

Kada se mjeri dužina telomera, da li se metoda izvodi na kolekciji ćelija koja daje prosjek?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Koje se metode koriste za mjerenje telomera kod ljudi ili životinja?

Može li se to uraditi na pojedinačnoj ćeliji?

Da li je sljedeća zabrinutost izneta i riješena ranije:

Šta ako postoji prirodna varijacija u dužini telomera od ćelije do ćelije i postoje različite metode (naporne vežbe itd.) koje vrše pritisak selekcije na dužinu telomera, onda ako metoda merenja na neki način uključuje više ćelija, imate efekat prosječna dužina se povećava dok se nešto drugo stvarno dogodilo. Kao rezultat svih ovih studija zaključeno je da se dužina telomera povećala.


Telomer se može izmjeriti pomoću flow-fish testa. U osnovi, fluorescentni markeri koji vezuju DNK uvode se u jezgro ćelije, a zatim se ti markeri mogu prebrojati korištenjem metode poziva protočna citometrija.

To se može uraditi na jednoj ćeliji

Nisam siguran da razumijem posljednji dio pitanja, ali mogu reći da ako se prosječna veličina telemorea poveća u određenoj veličini uzorka, onda naučnici neće zaključiti ništa na osnovu tih podataka.

Ako postoji znanstveni zaključak o veličini telomera u odnosu na vanjske selektivne pritiske, postojali bi statistički značajni podaci koji pravilno objašnjavaju varijacije uočene u različitim ćelijama.


Kvantitativna PCR metoda za mjerenje apsolutne dužine telomera

Opisujemo jednostavnu i ponovljivu metodu za mjerenje apsolutne dužine telomera (aTL) korištenjem kvantitativne lančane reakcije polimeraze u realnom vremenu (qPCR). Ova metoda je bazirana na Cawthon metodi za relativno mjerenje dužine telomera (TL), ali je modificirana uvođenjem standarda oligomera za mjerenje aTL. Metoda opisuje standarde oligomera, generiranje standardne krive i proračune potrebne za izračunavanje aTL-a iz qPCR podataka. Potrebne kontrole i karakteristike performansi testa su detaljno opisane i upoređene u odnosu na druge metode za merenje TL. Dati su tipični rezultati za ovaj test za različite uzorke ljudskog tkiva, kao i raspored rješavanja problema. Ova metoda omogućava visoko propusno mjerenje aTL-a koristeći male količine DNK što ga čini pogodnim za molekularne epidemiološke studije. U poređenju sa tradicionalnim relativnim TL qPCR testovima, aTL metoda opisana u ovom protokolu omogućava direktnije poređenje rezultata između eksperimenata unutar i između laboratorija.


Pozadina

Rašireno je mišljenje da žene imaju duže telomere od muškaraca, iako su rezultati studija kontradiktorni.

Metode

Proveli smo sistematski pregled i meta-analize kako bismo testirali hipotezu da kod ljudi žene imaju duže telomere od muškaraca i da ta povezanost postaje jača sa starenjem. Pretrage su obavljene u EMBASE i MEDLINE (do novembra 2009.) i dodatni skupovi podataka su dobijeni od istraživača. Prikladne opservacijske studije mjerile su telomere i za žene i za muškarce bilo koje dobi, imale su minimalnu veličinu uzorka od 100 i uključivale su sudionike koji nisu dio oboljele grupe. Izračunali smo zbirne procjene korištenjem meta-analize slučajnih efekata. Heterogenost između studija istraživana je analizom podgrupa i meta-regresijom.

Rezultati

Meta-analize iz 36 kohorti (36.230 učesnika) pokazale su da su žene u prosjeku imale duže telomere od muškaraca (standardizirana razlika u dužini telomera između ženki i muškaraca 0,090, 95% CI 0,015, 0,166 prilagođeno starosti). Bilo je malo dokaza da su ove asocijacije varirale prema starosnoj grupi (p = 1,00) ili tipu ćelije (p = 0,29). Međutim, veličina ove razlike je varirala u zavisnosti od metoda mjerenja, pri čemu je samo Southern blot, ali ni PCR u realnom vremenu niti Flow-FISH pokazali značajnu razliku. Ova razlika nije povezana sa slučajnom greškom mjerenja.

Zaključci

Dužina telomera je duža kod ženki nego kod muškaraca, iako ova razlika nije univerzalno pronađena u studijama koje nisu koristile Southern blot metode. Potrebno je dalje istraživanje objašnjenja metodoloških razlika.


Telomere u stresu

Telomere štite integritet hromozoma. Oni postaju kraći sa svakom diobom ćelije u većini stanica budući da telomeraza nije aktivna u velikoj većini ljudskih stanica [10]. Moglo bi se reći da "žrtvuju" sebe. Pogotovo zato što gubitak telomerne sekvence nije toliko kritičan za trenutni metabolički status ćelije kao gubitak sekvence DNK koja kodira protein. Ostale funkcije telomera uključuju sprečavanje hromozoma da se spoje ili postanu prepoznati kao prekidi dvostrukog lanca DNK, što bi zauzvrat upozorilo mehanizme popravke DNK [11]. Međutim, s vremenom se dužina telomera u normalnim stanicama smanjuje sve dok ne postanu prekratke da bi odigrale svoju ulogu i održale stanice sposobne za podjelu. rezultira ćelijskim starenjem koje je jedan od glavnih uzroka starenja i poremećaja povezanih sa starenjem [12] povezanih s problemom krajnje replikacije (Hayflickova granica) [13].

Ekspresija i aktivnost telomeraze u ljudskim ćelijama opadaju sa godinama [14]. Međutim, to je individualni fenomen i stopa trošenja telomera povezana je, između ostalog, sa sposobnošću savladavanja stresa. Kao što se sugerira, fizička aktivnost (koja se smatra jednim od glavnih načina za smanjenje nivoa stresa) povezana je sa zdravim starenjem i smanjenim rizikom od nekoliko kroničnih poremećaja, vjerojatno zbog obnove telomera [15, 16]. Na ćelijskom nivou, stres se odnosi na faktore koji mogu uticati na metabolizam ili mogu oštetiti ćeliju. Međutim, bez obzira na razinu, stres se progresivno akumulira zajedno sa starenjem i može negativno utjecati na zdravlje i dobrobit pojedinca. Važno je da se pokazalo da antioksidansi odgađaju početak vaskularnog starenja na način ovisan o telomerazi. U in vitro studiji, pokazalo se da reaktivne vrste kiseonika (ROS) smanjuju nivo proteina nuklearnog hTERT (ljudske telomeraze reverzne transkriptaze) (ključne podjedinice telomeraze) i aktivnost telomeraze u endotelnim ćelijama, što je praćeno razvojem fenotipa starenja. . U isto vrijeme, inkubacija s antioksidansom N-acetilcisteinom blokirala je ovaj nuklearni izvoz hTERT-a u citosol, što ukazuje na njegovu ulogu u odgovoru na stres [17]. Pokazalo se da drugi dobro poznati antioksidans — a-tokoferol potiskuje skraćivanje telomera i zadržava aktivnost telomeraze u mikrovaskularnim endoteliocitima mozga [18]. Slično, pokazalo se da ekstrakt Ginko Bilobe (visokog antioksidativnog potencijala) odgađa početak starenja kroz aktiviranje telomeraze putem PI3k/Akt signalnog puta [19, 20]. Važno je da hronični stres dovodi do povećanog lučenja kortizola koji je sposoban da potisne aktivaciju telomeraze u imunološkom sistemu i, posljedično, promoviše trošenje telomera [21].

Činjenica je da starenje prati trošenje telomera, iako je njegova stopa vrlo heterogena između pojedinaca, različitih tipova ćelija ali i različitih hromozoma [22]. Naročito najnoviji aspekt navodi na zaključak da ćelije mogu prerano podvrgnuti starenju, čak i kada je prosječna dužina telomera "normalna", ali su neki specifični krajevi hromozoma kritično kratki. Budući da postoje neki biohemijski putevi koji su zajednički za starenje, odgovor na stres i trošenje telomera, vjerujemo da su krajevi hromozoma vrlo osjetljivi markeri stresa i pouzdani pokazatelji ćelijskog starenja. Međutim, čini se da je jedini način da se prizna dužina telomera kao marker starenja/starenja/izloženosti stresu da se proceni dužina/stopa trošenja pojedinačnih pojedinačnih hromozoma, a ne da se u proseku meri ukupna dužina telomera.

Još jedan ključni izvještaj su demonstrirali Garrett-Bakelman et al., koji su demonstrirali studiju povezanu sa izlaganjem smanjenoj gravitaciji. Kao što je prikazano, astronaut (Scott Kelly), koji je proveo skoro godinu dana na međunarodnoj svemirskoj stanici, doživio je neke teške sindrome (smanjena tjelesna masa, nestabilnost genoma, oticanje velikih krvnih žila, promjene u obliku očiju, promjene metabolizma, upale i promjene u njegovom mikrobiomu), ali i značajno produženje telomera. Važno je da se hromozomski krajevi ponovo skraćuju nakon što je astronaut sletio i vratio se na nivoe skoro pre leta u roku od 6 meseci nakon povratka na Zemlju. Međutim, uočen je povećan broj kratkih telomera, a ekspresija nekih gena je i dalje poremećena. U isto vrijeme, njegov identični brat blizanac (nije proveo vrijeme u svemiru) je praćen kao referenca koja nije pokazala značajne promjene u dužini telomera [23]. Ovaj slučaj pokazuje koliko je složena regulacija telomera.


Metode

Subjekti i kontrole

Studija zdravlja pluća (LHS). U studiji su korišteni klinički podaci i biološki materijali dobiveni u Studiji zdravlja pluća (LHS), kliničkom ispitivanju pod pokroviteljstvom Nacionalnog instituta za srce, pluća i krv. Nakon prijema pismenog informiranog pristanka, LHS je prvobitno uključio 5887 pušača, starosti 35� godina sa blagim do umjerenim ograničenjem protoka zraka (definirano kao omjer forsiranog izdisajnog volumena u jednoj sekundi (FEV1) na forsirani vitalni kapacitet (FVC)𢙀.70 i 55㳾V1㲐% predviđeno) u 10 centara u Sjevernoj Americi [15]. Osobe koje su imale anamnezu raka (osim karcinoma in situ ili karcinoma bazalnih ćelija kože), infarkta miokarda (u protekle dvije godine), angine pektoris, zatajenja srca, moždanog udara (u posljednje dvije godine), zatajenja bubrega, inzulina- Isključeni su dijabetes melitus, ciroza ili druga ozbiljna oboljenja jetre, plućna embolija, poremećaji centralnog nervnog sistema, glaukom uskog ugla ili bilo koje druge ozbiljne bolesti koje bi mogle da ugroze praćenje [16].

Tokom prvih 5 godina praćenja, plućna funkcija učesnika i pušački status procjenjivani su svake godine. Učesnici su kategorizirani kao osobe koje su trajno odustale od pušenja ako su prilikom svake godišnje posjete potvrđene kao nepušači. Učesnici koji su bili pušači u svakoj godišnjoj posjeti bili su stalni pušači. Oni čije je ponašanje pušenja variralo klasifikovani su kao povremeni odvikivači. U 5. godini, 4.803 učesnika dalo je uzorke krvi (što predstavlja 89% kvalifikovanih učesnika). Uzorci krvi su razdvojeni na sastavne dijelove i čuvani u �ଌ zamrzivačima do upotrebe. Učesnici studije su zatim pasivno praćeni sve do kraja 2001. godine u proseku praćenja od 7,5 godina od datuma punkcije vene do zatvaranja studije. Tokom praćenja, evidentiran je vitalni status učesnika i hospitalizacija. Odbor za mortalitet i morbiditet pregledao je sve kartone pacijenata, uključujući izvode iz matične knjige umrlih, iskaze očevidaca, obdukcije, sažetke intervjua sa ljekarima koji prisustvuju i evidenciju o hospitalizaciji i odredio uzrok smrtnosti za sve umrle. Ovi podaci su dopunjeni Nacionalnim indeksom smrti koji je dao datum i uzrok smrti za sve učesnike američke studije [16]. Krajnje tačke mortaliteta grupisane su u: koronarna bolest srca, kardiovaskularna bolest (koja je takođe uključivala koronarnu bolest), rak pluća, svi karcinomi (koji su uključivali rak pluća), respiratorne bolesti isključujući rak pluća, druge i nepoznato.

Kohorta studija zdravog starenja. Da bismo uporedili dužinu telomera ispitanika sa KOPB-om u LHS-u sa kontrolnom grupom bez KOPB-a, koristili smo podatke o telomerima sredovečnih subjekata iz Studije o zdravom starenju, koji su bili između 40 i 50 godina starosti i bili su nasumično regrutovani bez obzira na zdravlje ili status bolesti (tj. “negativna” kontrola) [17].

Advair, Biomarkeri u kohorti COPD (ABC). Kao druga kontrolna grupa (tj. “pozitivne” kontrole), izmjerili smo dužinu telomera perifernih leukocita dobijenih od pacijenata sa umjerenom do teškom KOPB-om, kako je spirometrijski definirano FEV-om.1/FVC odnos manji od 70% i FEV1 manje od 80% predviđenih, koji su imali istoriju pušenja od najmanje 10 paketa godina i imali su najmanje 40 godina [18]. Rezultati ove studije su ranije objavljeni [13].

Ekstrakcija DNK leukocita

Koncentracija DNK iz periferne krvi sakupljene 5. godine određena je spektrofotometrom NanoDrop 8000 (Thermo Scientific, Wilmington, SAD). Uzorci DNK su razrijeđeni do 1 ng/µL u 1× Tris-EDTA puferu i pohranjeni na �ଌ za naknadnu upotrebu u kvantitativnoj lančanoj reakciji polimeraze (qPCR).

Mjerenje dužine telomera

Telomeri leukocita periferne krvi mjereni su korištenjem modificiranog qPCR protokola koji je opisao Cawthon [19]. Prajmer sekvence (napisane 5′𡤣′) bile su: tel 1, GGTTTTTGAG -GGTGAGGGTGAGGGTGAGGGTGAGGGT tel 2, TCCCGACTATCCCTATCCCTATCCC -TATCCCTATCCCTA 36B4u, CAGCAAGTGGGAAGGTGTAATCC 36B4d, CCCATTCTA -TCATCAACGGGTACAA. Korišteni referentni gen za jednu kopiju bio je 36B4, a konačne koncentracije prajmera (Sigma, The Woodlands, TX) bile su tel 1, 270 nM tel 2, 900 nM, 36B4u, 300 nM 36B4d, 500 nM.

Mjerenje dužine telomera izvršeno je u tri primjerka za sve uzorke u Clear Optical Reaction Plate sa 384 jažica (Applied Biosystems, Foster City, CA). Referentna DNK dobijena od Instituta Coriell (Camden, NJ) je analizirana u tri primjerka na svakoj PCR ploči kako bi se uzela u obzir varijacije mjerenja među pločama. Svaki bunar sadržavao je 10 µL QuantiTect SYBR Green PCR Master Mix (QIAGEN, Mississauga, ON) i konačnu koncentraciju DNK od 0,25 ng/µL. Nakon punjenja, ploče su zapečaćene MicroAmp optičkim adhezivnim filmom (Applied Biosystems, Foster City, CA) i kratko centrifugirane na 2500 o/min. Reakcije su izvedene u ABI PRISM 7900HT sistemu za detekciju sekvenci (Applied Biosystems, Foster City CA). Profil termičkog ciklusa i za telomere i za amplifikaciju gena u jednoj kopiji počeo je sa 50ଌ u trajanju od 2 min, a zatim na 95ଌ tokom 2 min. Za PCR telomere, usledilo je 30 ciklusa od 95ଌ tokom 15 s i 54ଌ tokom 2 min. Profil ciklusa 36B4 je praćen sa 35 ciklusa od 95ଌ u trajanju od 15 s i 58ଌ u trajanju od 1 min. Dužina telomera je kvantifikovana kao relativni odnos T/S (T = telomere, S = single copy gen), izračunat prema Cawthonovoj formuli [19].

Statistička analiza

Dužina telomera leukocita periferne krvi standardizovana je prema referentnom genu za jednu kopiju (T/S). Za analitičke svrhe, učesnici su podijeljeni u kvartile na osnovu njihovog T/S omjera. Kliničke karakteristike su zatim upoređene korišćenjem hi-kvadrat testa za dihotomne varijable (koristeći odgovarajuće stepene slobode) i Cochran-Armitage testa za trend za kontinuirane varijable. Primarna krajnja tačka za ovu studiju bila je smrtnost od svih uzroka. Uporedili smo rizik od smrtnosti od svih uzroka u kvartilima tokom perioda praćenja koristeći Kaplan-Meier (K-M) metodu za univarijantnu analizu i Coxov proporcionalni model opasnosti za multivarijantnu analizu. K-M krive preživljavanja u T/S kvartilima su upoređene korištenjem log-rank testa. U multivarijantni model uključili smo sljedeće kovarijate: dob, spol, indeks tjelesne mase (BMI), pušački status kroz prvih 5 godina praćenja, godine pušenja, krvni tlak u 5. godini i FEV1 u 5. godini FEV1, BMI, mjerenje krvnog tlaka i pušenje u godinama nisu značajno utjecali na rezultate modela. Tako su u konačnoj analizi odbačeni. Sličan pristup korišten je za krajnje točke mortaliteta specifične za uzrok. Odnosi T/S u grupama pušača upoređivani su korištenjem Kruskal-Wallis testa, jer podaci nisu bili normalno raspoređeni. Korelacije između T/S omjera i varijabli kao što je FEV1 u dobi od 5 godina testirani su Spearmanovim testom za neparametarske varijable. P-vrijednosti manje od 0,05 (koristeći dvostrani test) smatraju se značajnim. Sve analize su sprovedene korišćenjem SAS-a (verzija 9.1, Carey, N.C.). Korištenje uzoraka LHS i ABC studija odobreno je od strane Providence Health Care/UBC Research Ethics Board. Korištenje uzoraka iz Studije zdravog starenja odobreno je od strane Zajedničkog odbora za etiku kliničkih istraživanja UBC-a i Agencije za rak Britanske Kolumbije.


Rezultati

Deskriptivna statistika i grupne razlike među varijablama istraživanja prikazane su u Tabeli 1. Bivarijantne korelacije su prikazane u tabeli 2. Kao što je prikazano u ovim tabelama, postojale su grupne razlike u težini rođenja i IQ-u. Također, porođajna težina, koeficijent inteligencije i spol bili su različito povezani s psihopatologijom. Stoga smo ponovo pokrenuli odvojene modele puta sa svakim od spola, IQ-a i porođajne težine kao kovarijate i rezultati se nisu bitno razlikovali. Kao što se vidi u Tabeli 1, nije bilo direktne povezanosti između dužine telomera u bilo kojoj vremenskoj tački i statusa grupe – bilo upoređujući NIG sa EIG, ili FCG sa CAUG. Kao što se vidi u Tabeli 2, postojala je stabilnost rang-reda u TL-u tokom vremena, što znači da su pojedinci sa kraćim telomerima u dobi od 8� imali tendenciju da imaju kraće telomere u dobi od 12� u poređenju sa onima s dužim telomerima. Štaviše, u skladu s prethodnim studijama, došlo je do skraćivanja telomera tokom vremena u cijelom uzorku, t (df ​​= 76) = 3,01, str = .004.

Tabela 1:

Karakteristike i deskriptivna statistika među institucionaliziranom i nikad neinstitucionaliziranom djecom

Dob 8� Mere
Svi učesniciSamo djeca u ustanovama
EIG (n= 96)NIG (n= 99)t ili χ 2 CAUG (n= 44)FCG (n= 52)t ili χ 2
Spol (% muškaraca)52.1%48.5%.2552.351.9.001
Rođena težina (g)2755.23208.05.06 *** 2847.52675.01.33
IQ pune skale80.2100.29.30 *** 78.281.91.29
Opšti faktor.45−.446.84 *** .51.40.57
Internalizirajući faktor.04−.04.63.12−.02.69
Eksternalizirajući faktor.00.00.06.06−.04.44
Dužina telomera1.601.59.061.531.65.74
Dob 12� Mere
Svi učesniciSamo djeca u ustanovama
EIG (n= 112)NIG (n= 50)t ili χ 2 CAUG (n= 56)FCG (n= 56)t ili χ 2
Spol (% muškaraca)51.846.0.4651.851.8<.001
Rođena težina (g)2799.53244.94.29 *** 2878.62722.01.31
IQ pune skale72.398.19.00 *** 68.675.82.19 *
Opšti faktor.20−.444.29 *** .34.061.52
Internalizirajući faktor−.05.111.22−.01−.09.58
Eksternalizirajući faktor.16−.374.44 *** .23.10.63
Dužina telomera1.401.43.641.381.41.59

Napomena: Sve statistike su srednje vrijednosti osim spola (%). Opće, internalizirajuće i eksternalizirajuće varijable su faktorski rezultati s ukupnom srednjom vrijednosti uzorka nula.

IQ je procijenjen korištenjem WISC-IV. Težina rođenja se mjeri u gramima. Rezultati dužine telomera su neprilagođeni u ovoj tabeli.

Tabela 2:

Bivarijantne korelacije između studijskih varijabli i drugih karakteristika djeteta

1.2.3.4.5.6.7.8.9.10.11.
1. Opšti faktor (8 godina�)
2. Internalizirajući faktor (8 godina�).00
3. Eksternalizirajući faktor (8 godina�).00.02
4. Dužina telomera (8 godina�)−.02−.19 § .03
5. Opšti faktor (12 godina�).29 ** .00−.09.18
6. Internalizirajući faktor (12 godina�)−.23 ** .12.04.03.15 §
7. Eksternalizirajući faktor (12 godina�).37 *** −.04.06−.02.04−.25 **
8. Dužina telomera (12 godina�)−.05−.25 ** .08.35 ** −.22 ** −.05−.01
9. Seks (muški).15 * −.07−.05.01.16 * .01.24 ** −.01
10. Težina rođenja−.23 ** −.09.23 ** .01−.22 ** −.13−.11−.16 § .09
11. FSIQ (8 godina�)−.54 *** −.10.05.04−.08.34 ***
12. FSIQ (dob 12�)−.31 *** .12−.32 *** .02−.08.29 ** .90 ***

S obzirom na prethodne nalaze vezano za spol između trajanja institucionalne njege i dužine telomera, predstavljamo korelacije između dužine vremena provedenog u ustanovama među EIG-om (procenat jednog života do određene dobi) i dužine telomera za muškarce i žene. učesnika u Tabeli S1, dostupnoj online. Duže trajanje institucionalnog zbrinjavanja za 54 mjeseca i 8 godina bilo je povezano sa kraćom dužinom telomera u dobi od 8� kod muških učesnika. Kod žena učesnica, duže trajanje institucionalne nege na početku i 54 meseca bilo je povezano sa kraćom dužinom telomera u dobi od 12�. Količina vremena provedenog u institucijama tokom vremena bila je u korelaciji (Tabela S2, dostupna online). Kada su trajanje institucionalnog zbrinjavanja i dužina telomera ispitani unutar FCG i CAUG (računajući spol), veća izloženost institucionalnoj njezi u dobi od 54 mjeseca, 8 godina i 12 godina bila je povezana sa kraćom dužinom telomera u dobi od 12� među CAUG, ali nije FCG (Tabela S3, dostupno na mreži). Spolne razlike nisu ispitivane unutar FCG i CAUG grupa zbog ograničenja snage. Proširujemo ove nalaze u Dodatku 1. Dakle, postoje veze između trajanja institucionalizacije i dužine telomera koje variraju na osnovu spola i starosti procjene, a ne direktne veze između institucionalne grupe i dužine telomera. Snažna veza između statusa institucionalizacije (NIG = 0 EIG = 1) i psihopatologije opravdava njeno uključivanje kao kovarijate u primarni model, koji je naveden u nastavku.

Povezanost između dužine telomera i psihopatologije

Model longitudinalne putanje koji opisuje odnos između dužine telomera i opštih, internalizujućih i eksternalizujućih faktora predstavljen je na slici 1. Prilagođavanje modela je bilo prihvatljivo: RMSEA = .069 [.02, .11], PCLOSE = .22, CFI = .90 i SRMR = .05. EIG djeca su imala značajno veću opću psihopatologiju u dobi od 8� nego NIG, ali status institucionalizacije nije bio povezan s internalizacijom ili eksternalizacijom u dobi od 8� nakon što se uzme u obzir opći faktor. Nadalje, postojala je relativna stabilnost u općoj psihopatologiji tokom vremena, bez obzira na institucionalni status, ali mala stabilnost u internalizaciji ili eksternalizaciji nakon što se uzme u obzir stabilnost u opštem faktoru.

Bilješka. Parametri su standardizovani β koeficijenti. Psihopatološki faktori su faktorski rezultati sačuvani iz latentnog bi-faktorskog modela i korišteni kao manifestne varijable. Prikazani su samo odnosi između dužine telomera i psihopatologije. Vidi Tabelu 1 za povezanost između rezultata psihopatoloških faktora. EIG = uvijek institucionalizirana grupa NIG = nikad institucionalizirana.

U smislu unutar vremena asocijacije, kraća dužina telomera u dobi od 8� bila je značajno povezana s većim problemima internalizacije, ali nije bila povezana s općom ili eksternalizirajućom psihopatologijom. S druge strane, kraća dužina telomera u dobi od 12� bila je povezana s višom općom, ali ne internalizirajućom ili eksternalizirajućom psihopatologijom. Konačno, kroz vrijeme efekti (tj. unakrsne asocijacije) otkrili su da je viša internalizirajuća psihopatologija u dobi od 8� predvidjela kraću dužinu telomera u dobi od 12� nakon kontrole dužine telomera u dobi od 8�. Ovaj efekat se može protumačiti kao veća internalizirajuća psihopatologija koja predviđa promjenu dužine telomera od 8� do 12�. Ni opća ni eksternalizirajuća psihopatologija u dobi od 8� nisu bile povezane s dužinom telomera u dobi od 12�, i nisu se pojavili recipročni efekti dužine telomera na psihopatologiju. Svi efekti su testirani istovremeno i uslovljeni svim ostalim efektima u modelu. Kako ovo nisu bili nezavisni testovi, nije bila potrebna korekcija za višestruko testiranje.

Konačno, u skladu s prvobitnom namjerom RCT-a, ispitali smo da li se veze između psihopatoloških faktora i dužine telomera razlikuju između: (i) EIG i NIG, i (ii) CAUG i FCG. Potonji model je ponudio lošu prilagodbu podacima, vjerovatno zbog neadekvatne snage s obzirom na malu veličinu uzorka CAUG i FCG grupa. Rezultati prethodnog modela dati su u Dodatku 1, dostupnom na internetu. Kako nije bilo vidljivih razlika u putevima koji povezuju psihopatologiju i dužinu telomera između EIG i NIG djece, primarni model iznad se srušio kod sve djece.


Priznanja

Ovaj pregled je rezultat diskusija i saradnje proizašlih iz radionice o dinamici telomera u nemodelnim organizmima. Radionica je podržana od strane BBSRC International Workshop Granta i dodatne podrške Genetics Society and Agilent Technologies, kao i od strane European Research Council Advanced Investigator Award za PM. Zahvalni smo svim učesnicima na radionici na njihovom doprinosu u našim raspravama o metodama mjerenja telomera, te Abrahamu Avivu, Hannah Froy i Francois Criscuolu na njihovim komentarima na nacrte rukopisa. DHN je podržan od strane BBSRC David Phillips stipendije.

Ime dokumenta Opis
mee312161-sup-0001-TableS1.docxWord dokument, 16,1 KB Tabela S1. Spisak vrsta i metoda skladištenja tkiva i ekstrakcije DNK i njihova pogodnost za naknadnu analizu dužine telomera, na osnovu dosadašnjeg iskustva autora i lične komunikacije sa kolegama. AE i TE se odnose na najčešće korišćene puferske rastvore: AE je mešavina natrijum acetata i EDTA, TE rastvora Tris i EDTA.

Napomena: Izdavač nije odgovoran za sadržaj ili funkcionalnost bilo koje prateće informacije koju su dali autori. Sve upite (osim sadržaja koji nedostaje) treba uputiti odgovarajućem autoru za članak.


Elektronski dodatni materijal dostupan je na mreži na https://doi.org/10.6084/m9.figshare.c.5001038.

Izdaje Kraljevsko društvo pod uslovima licence Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, koja dozvoljava neograničenu upotrebu, pod uslovom da se navede originalni autor i izvor.

Reference

. 2006. Da li dinamika telomera povezuje stil života i životni vijek? Trends Ecol. Evol. 21, 47-53. (doi:10.1016/j.tree.2005.11.007) Crossref, PubMed, ISI, Google Scholar

. 2010. Telomeri i životne istorije: dugo i kratko. Ann. NY Acad. Sci. 1206, 130-142. (doi:10.1111/j.1749-6632.2010.05705.x) Crossref, PubMed, ISI, Google Scholar

Haussmann MF, Marchetto NM

. 2010 Telomeri: povezivanje stresa i preživljavanja, ekologije i evolucije. Cur. Zool. 56, 714-727. (doi:10.1093/czoolo/56.6.714) Crossref, ISI, Google Scholar

Olsson M, Wapstra E, Friesen CF

. 2018 Evolucijska ekologija telomera: pregled. Ann. NY Acad. Sci. 1422, 5-28. (doi: 10.1111/nyas.13443) Crossref, PubMed, ISI, Google Scholar

Olsson M, Wapstra E, Friesen CR

. 2018 Ektotermni telomeri: vrijeme je da dođu sa hladnoće. Phil. Trans. R. Soc. B 373, 20160449. (doi: 10.1098/rstb.2016.0449) Link, ISI, Google Scholar

Gomes N, Shay JW, Wright WE

. 2010 Biologija telomera u Metazoa. FEBS Lett. 584, 3741-3751. (doi:10.1016/j.febslet.2010.07.031) Crossref, PubMed, ISI, Google Scholar

. 2015 popravka ekscizije DNK na telomerima. DNK popravka 36, 137-145. (doi:10.1016/j.dnarep.2015.09.017) Crossref, PubMed, ISI, Google Scholar

. 2018 Oštećenje DNK, popravka i održavanje dužine telomera: uloga dodataka ishrani . U Mutagenost: testovi i primjena (eds

Kumar A, Dobrovolsky VN, Dhawan A, Shanker R

), str. 287-307. Amsterdam, Holandija : Elsevier . Google Scholar

2017 Prevalencija i etiologija raka kod divljih životinja i životinja u zatočeništvu. U Ekologija i evolucija raka (eds

Ujvari B, Roche B, Thomas F

), str. 11-46. London, UK: Academic Press. Crossref, Google naučnik

. 2009 Telomeri i bolest . EMBO J. 28, 2532-2540. (doi:10.1038/emboj.2009.172) Crossref, PubMed, ISI, Google Scholar

. 2012 Telomerni sindromi. Nat. Rev. Genet. 13, 693-704. (doi:10.1038/nrg3436) Crossref, PubMed, ISI, Google Scholar

Stone RC, Horvath K, Kark JD, Susser E, Tishkoff SA, Aviv A

. 2016 Dužina telomera i kompromis između raka i ateroskleroze . PLoS Genet. 12, e1006144. (doi:10.1371/journal.pgen.1006144) Crossref, PubMed, ISI, Google Scholar

Barrett ELB, Richardson DS

. 2011 Polne razlike u telomerima i životnom veku. Aging Cell 10, 913-921. (doi:10.1111/j.1474-9726.2011.00741.x) Crossref, PubMed, ISI, Google Scholar

2014 Spol i dužina telomera: sistematski pregled i meta-analiza . Exp. Gerontol. 51, 15-27. (doi:10.1016/j.exger.2013.12.004) Crossref, PubMed, ISI, Google Scholar

Rollings N, Friesen CR, Sudyka J, Whittington C, Giraudeau M, Wilson M, Olsson M

. 2017 Dinamika telomera kod guštera s reproduktivnim ulaganjem specifičnim za morf i samoodržavanje. Ecol. Evol. 7, 5163-5169. (doi:10.1002/ece3.2712) Crossref, PubMed, ISI, Google Scholar

Asghar M, Palinauskas V, Zaghdoudi-Allan N, Valkiunas G, Mukhin A, Platonova E, Farnert A, Bensch S, Hasselquist D

. 2016 Paralelno skraćivanje telomera u višestrukim tjelesnim tkivima zbog infekcije malarijom. Proc. R. Soc. London. Biol. Sci. 283, 20161184. (doi:10.1098/rspb.2016.1184) Link, ISI, Google Scholar

Rollings N, Friesen CR, Whittington CM, Johansson R, Shine R, Olsson M

. 2019 Razlike za spol i tkivo u dužini telomera kod reptila. Ecol. Evol. 9, 6211-6219. (doi:10.1002/ece3.5164) PubMed, ISI, Google Scholar

Benetos A, Kimura M, Labat C, Buchoff GM, Huber S, Labat L, Lu XB, Aviv A

. 2011 Model dinamike telomera leukocita pasa. Aging Cell 10, 991-995. (doi:10.1111/j.1474-9726.2011.00744.x) Crossref, PubMed, ISI, Google Scholar

Daniali L, Benetos A, Susser E, Kark JD, Labat C, Kimura M, Desai K, Granick M, Aviv A

. 2013 Telomeri se skraćuju jednakom brzinom u somatskim tkivima odraslih. Nat. Commun. 4, 1597. (doi:10.1038/ncomms2602) Crossref, PubMed, ISI, Google Scholar

Reichert S, Criscuolo F, Verinaud E, Zahn S, Massemin S

. 2013 Korelacije dužine telomera među somatskim tkivima kod odraslih zebrica. PLoS ONE 8, e81496. (doi:10.1371/journal.pone.0081496) Crossref, PubMed, ISI, Google Scholar

. 2004 Hematologija donjih kralježnjaka . Na 55. godišnjem sastanku Američkog koledža veterinarskih patologa (ACVP) i 39. godišnjem sastanku Američkog društva za kliničku patologiju (ASVCP). Middleton, WI: Američki koledž veterinarskih patologa i Američko društvo za veterinarsku kliničku patologiju. Google Scholar

Beaulieu M, Benoit L, Abaga S, Kappeler PM, Charpantier MJE

. 2017 Pazite na ćeliju: sezonske varijacije u dužini telomera odražavaju promjene u profilu leukocita. Mol. Ecol. 26, 5603-5613. (doi:10/1111/mec.14329) Crossref, PubMed, ISI, Google Scholar

. 2009 Komparativna morfologija, razvoj i funkcija krvnih stanica u kralježnjaka nesisara . J. Exot. Pet. Med. 18, 87-97. Crossref, ISI, Google Scholar

. 2019 Fiziologija crvenih i bijelih krvnih zrnaca . Anaesth. Intenzivna njega Med. 20, 170-174. (doi:10.1016/j.mpaic.2019.01.001) Crossref, ISI, Google Scholar

. 2002 Oksidativni stres skraćuje telomere. Trends Biochem. Sci. 27, 339-344. (doi:10.1016/S0968-0004(02)02110-2) Crossref, PubMed, ISI, Google Scholar

Baerlocher GM, Lansdorp PM

. 2003 Mjerenje dužine telomera u podskupovima leukocita pomoću automatiziranog višebojnog Flow-FISH-a. Citometrija, dio A 55A, 1-6. (doi:10.1002/cyto.a.10064) Crossref, ISI, Google Scholar

Carvalho de MP, Queiroz-Hazarbassanov NG, Massoco CO, Rossi S, Sant'Anna SS, Catão-Dias JL, Grego KF

. 2016. Protočna citometrijska karakterizacija populacija leukocita periferne krvi 3 neotropske vrste zmija: Boa constrictor, Bothrops jararaca, i Crotalus durissus . Vet. Clin. Pathol. 45, 271-280. (doi: 10.1111/vcp.12358) Crossref, PubMed, ISI, Google Scholar

Carvalho de MPN, Queiroz-Hazarbassanov NGT, de Oliveira Massoco C, Sant'Anna SS, Lourenço MM, Levin G, Sogayar MC, Grego KF, Catão-Dias JL

. 2017 Funkcionalna karakterizacija podskupina leukocita periferne krvi neotropskih zmija: povezivanje karakteristika ćelija protočne citometrije, mikroskopskih slika i nivoa kortikosterona u serumu. Dev. Comp. Immunol. 74, 144-153. (doi:10.1016/j.dci.2017.04.007) Crossref, PubMed, ISI, Google Scholar

Olsson M, Friesen CR, Rollings N, Sudyka J, Lindsay W, Whittington C, Wilson MR

. 2018 Dugoročni efekti popravke superoksida i DNK na telomere guštera. Mol. Ecol. 27, 5154-5164. (doi:10.1111/mec.14913) Crossref, PubMed, ISI, Google Scholar

Rollings N, Friesen CR, Sudyka J, Whittington C, Wilson M, Olsson M

. 2017 Dinamika telomera kod guštera s reproduktivnim ulaganjem specifičnim za morf i samoodržavanje. Ecol. Evol. 7, 5163-5169. (doi:10.1002/ece3.2712) Crossref, PubMed, ISI, Google Scholar

Olsson M, Healey M, Wapstra E, Schwartz T, Lebas N, Uller T

. 2007 Varijacije sistema parenja i morfološke fluktuacije kod polimorfnog guštera. Mol. Ecol. 16, 5307-5315. (doi:10.1111/j.1365-294X.2007.03578.x) Crossref, PubMed, ISI, Google Scholar

Olsson M, Healey M, Wapstra E, Uller T

. 2009 Testiranje kvaliteta nosača: terenski eksperiment na signalizatorima guštera . Evolucija 63, 695-701. (doi:10.1111/j.1558-5646.2008.00569.x) Crossref, PubMed, ISI, Google Scholar

. 2009. Prevelika za njegove čizme: da li su socijalni troškovi održavanja statusa ovisnog o stanju signalizirajući poštenje kod australskog guštera? Austral Ecol. 34, 636-640. (doi:10.1111/j.1442-9993.2009.01968.x) Crossref, ISI, Google Scholar

. 2000 Chapter 21: Reptilian complete blood count . U Laboratory medicine: avian and exotic pets (ed.

), pp. 193-197. Philadelphia, PA : W.B. Saunders Company . Google Scholar

Stacy NI, Alleman AR, Sayler KA

. 2011 Diagnostic hematology of reptiles . Clin. Lab. Med. 31, 87-108. (doi:10.1016/j.cll.2010.10.006) Crossref, PubMed, ISI, Google Scholar

. 2008 Hematologic evaluation is mainstay of diagnosis for reptiles . Vet. Tech. 29, 616. Google Scholar

Nazarpour R, Zabihi E, Alijanpour E, Abedian Z, Mehdizadeh H, Rahimi F

. 2012 Optimization of human peripheral blood mononuclear cells (PBMCs) cryopreservation . Int. J. Mol. Cell. Med. 1, 88-93. PubMed, Google Scholar

. 1991 Structure and function of telomeres . Priroda 350, 569-573. (doi: 10.1038/350569a0) Crossref, PubMed, ISI, Google Scholar

Fischer U, Ototake M, Nakanishi T

. 1998 Lifespan of circulating blood cells in ginbuna crucian carp (Carassius auratus langsdorfii) . Fish Shellfish Immunol. 8, 339-349. (doi:10.1006/fsim.1998.0144) Crossref, ISI, Google Scholar

Asghar M, Hasselquist D, Hansson B, Zehtindjiev P, Westerdahl H, Bensch S

. 2015 Hidden costs of infection: chronic malaria accelerates telomere degradation and senescence in wild birds . Nauka 347, 436-438. (doi10.1126/science.1261121) Crossref, PubMed, ISI, Google Scholar

Angelier F, Costantini D, Blévin P, Chastel O

. 2018 Do glucocorticoids mediate the link between environmental conditions and telomere dynamics in wild vertebrates? Pregled . Gen. Comp. Endocrinol. 256, 99-111. (doi:10.1016/j.ygcen.2017.07.007) Crossref, PubMed, ISI, Google Scholar

Kurz DJ, Decary S, Hong Y, Trivier E, Akhmedov A, Erusalimsky JD

. 2004 Chronic oxidative stress compromises telomere integrity and accelerates the onset of senescence in human endothelial cells . J. Cell Sci. 117, 2417-2426. (doi:10.1242/jcs.01097) Crossref, PubMed, ISI, Google Scholar

Fouquerel E, Parikh D, Opresko P

. 2016 DNA damage processing at telomeres: the ends justify the means . DNK popravka 44, 159-168. (doi:10.1016/j.dnarep.2016.05.022) Crossref, PubMed, ISI, Google Scholar

Sardina JL, Lopez-Ruano G, Sanchez-Sanchez B, Llanillo M, Hernandez-Hernandez A


Design and methods

Setting and subjects

This analysis was performed within the framework of the Prevention of Renal and Vascular End-Stage Disease (PREVEND, www.prevend.org) study. The PREVEND study is an ongoing, longitudinal, general, population-based cohort study of individuals aged 28–75 years living in the city of Groningen, the Netherlands. For the present study, we included subjects who donated a full blood sample for DNA extraction at baseline (T1) and/or during the first (T2) and/or the second (T3) follow-up visit. Details of the study have been described previously 15 . In brief, 8592 subjects completed the baseline survey (1997–1998) and were invited to visit the outpatient department after approximately 4.3 years for the first and approximately 6.6 years for the second follow-up visit. At each visit, demographic and anthropometric characteristics and serum biomarkers were assessed. The PREVEND study has been approved by the local medical ethics committee and is being conducted in accordance with the guidelines of the Declaration of Helsinki. All participants provided written informed consent before enrolment.

Measurement of telomere length

Details of the methods of DNA extraction and of telomere length measurements are provided in the Appendix S1. In brief, all samples for DNA collected at different time-points were mixed and randomly extracted using a standard DNA extraction kit (QIamp, Qiagen, Venlo, the Netherlands) to neutralize potential batch effects. Mean relative leukocyte telomere length was measured using a monochrome multiplex real-time quantitative polymerase chain reaction technique (developed by R.M.C.) 16 . This technique enables the telomere-specific amplification and the single copy gene (reference) amplification to be carried out in a single reaction well with quantification measurements at different temperatures 16 . The ratio of telomere (T) to single copy gene (S) content (T/S ratio) is a relative measure of telomere length (RTL) and is expressed in arbitrary units (RTLU). All samples were measured in triplicate, and the average of the three runs was used to provide the mean RTLU for each individual. The intra-assay coefficients of variation were 2.0%, 1.9% and 4.5% for T, S and the T/S ratio, respectively.

We adhered to the arbitrary categorization of telomere trajectories as previously reported: shortening was defined as a >10% decrease in RTL, stable as a ≤10% change in RTL and elongation as a >10% increase in RTL at T3 compared to baseline 17, 18 .

Other measurements and definitions

All participants completed a questionnaire regarding demographic profile and smoking habits. Smoking was categorized as current smoking, previous smoking and nonsmoking. Body mass index (BMI) was calculated as weight (kg) divided by height squared (m 2 ) and categorized as follows: normal, <25 kg m −2 overweight, 25–30 kg m −2 and obese, ≥30 kg m −2 . Hypertension was defined as systolic blood pressure ≥140 mmHg, diastolic blood pressure ≥90 mmHg or the use of antihypertensive medication prehypertension was defined as systolic blood pressure <140 and ≥120 mmHg and diastolic blood pressure <90 and ≥80 mmHg and normotension was defined as both systolic blood pressure <120 mmHg and diastolic blood pressure <80 mmHg. Diabetes was defined as a fasting plasma glucose level of ≥126 mg dL −1 (7.0 mmol L −1 ), a nonfasting plasma glucose level of ≥200 mg dL −1 (11.1 mmol L −1 ) or the use of oral antidiabetic agents. Hypercholesterolaemia was defined as a total cholesterol level of ≥250 mg dL −1 (6.5 mmol L −1 ) or the use of lipid-lowering medication ≤200 mg dL −1 (5.13 mmol L −1 ) was considered an optimal cholesterol concentration. Estimated glomerular filtration rate (eGFR) was calculated using the Modification of Diet in Renal Disease (MDRD) study equation taking into account sex, age, ethnicity and serum creatinine levels 19 . Details of the measurement methods can be found in the Appendix S1.

Statistička analiza

To obtain a normal distribution, telomere length was natural-log-transformed. Other continuous variables with a skewed distribution (creatinine, insulin, glucose, high-sensitivity C-reactive protein, cholesterol, HDL and triglycerides) were also natural-log-transformed prior to analysis. Individuals in the bottom and top 0.5% of the RTL distribution were excluded to limit the undue influence of outliers in the regression analysis. Differences in telomere lengths between groups were tested using Student's t-test or one-way anova . Cross-sectional associations between variables and telomere length were evaluated using standard linear regression models. Multivariate linear regression models were used to adjust for age and gender. To investigate telomere dynamics across time, two-level hierarchical growth models were constructed. Variables were centred around the grand mean (i.e. the mean was set to zero). Details of the model-building strategy, centring and multitest correction are provided in the Appendix S1.


Zaključci

Numerous observational studies of TL have been conducted among breast cancer patients in the last 20 years. Despite the major methodologic differences between studies, when considering all the studies (peripheral blood and tumor tissue) and all outcomes together, there was a trend toward an association of longer telomeres with a better prognosis. Further longitudinal studies with rigorous methodology, including proper control of confounding and an adequate TL measurement method, are still needed to determine the exact prognostic significance of TL for breast cancer patients.


Pogledajte video: Бързи анти стрес техники - намали стрес по лесен начин с ТЕС! (Decembar 2022).