Informacije

Odnos između našeg mikrobioma i personalizirane prehrane

Odnos između našeg mikrobioma i personalizirane prehrane


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Nedavno je postavljeno pitanje da li postoje 'metabolički tipovi' među ljudima koji mogu imati koristi od vrste personalizirane prehrane. Jedan od odgovora sugerirao je da bi jedan od faktora uviđanja mogao biti ljudski mikrobiom. Poznato je da simbiotska stanja domaćina i mikroba mogu različito reagirati na prehranu i unos lijekova, ali manje mi je jasno može li to biti korisno za personaliziranu prehranu. Pitam se:

utječe li mikrobiom na metabolizam hrane? (korisno za personalizovanu ishranu)

ILI

Da li hrana koju jedemo utiče na mikrobiom? (manje korisno za personaliziranu prehranu)

Znam da je odgovor vjerovatno oba, ali postoje primjeri koji uzročno pokazuju jednu granu i isključuju drugu?


utječe li mikrobiom na metabolizam hrane?

Definitivno (i ne iznenađujuće). Arumugam rad [1] to bilježi

Vozači iz [enterotip 1] izgleda da crpi energiju prvenstveno iz ugljikohidrati i proteini fermentacijom,… jer su geni koji kodiraju enzime uključene u razgradnju ovih supstrata (galaktozidaze, heksosaminidaze, proteaze) zajedno sa putevima glikolize i pentoza fosfata obogaćeni ovim enterotipom [… ]

Enterotip 2... je obogaćen Prevotellom... i Desulfovibrio koji se istovremeno pojavljuje, koji može djelovati u sinergiji sa razgrađuju mucinske glikoproteine ​​prisutne u mukoznom sloju crijeva [… ]

Enterotip 3 je […] obogaćen membranskim transporterima, uglavnom šećerima, što ukazuje na efikasno vezivanje mucina i njegovu kasniju hidrolizu, kao i na usvajanje rezultirajućih jednostavnih šećera ovim rodovima. […]

Obogaćeni rodovi ukazuju na to enterotipovi koriste različite puteve za stvaranje energije iz fermentabilnih supstrata dostupnih u debelom crijevu, što podsjeća na potencijalnu specijalizaciju u ekološkim nišama ili cehovima. Osim pretvaranja složenih ugljikohidrata u supstrate koji se mogu apsorbirati, crijevna mikrobiota također je korisna za ljudskog domaćina proizvodnjom vitamina. Iako su svi putevi metabolizma vitamina zastupljeni u svim uzorcima, enterotipovi 1 i 2 obogaćeni su biosintezom različitih vitamina [… ]

[Sav naglasak moj.]

Da li hrana koju jedemo utiče na mikrobiom?

Da, isto tako sigurno. Nemam pri ruci publikaciju, ali trebalo bi biti očito da naša hrana utječe na mikrobiom crijeva - u ekstremnom slučaju može ga ubiti (uzmite u obzir nuspojave antibiotika).

[1] Manimozhiyan Arumuga, Jeroen Raes & al., Enterotipovi mikrobioma crijeva čovjeka, Priroda 473, 174-180, maj 2011.


Da, mikrobiom utječe na metabolizam hrane, a prehrana utječe na sastav mikrobioma. +1 Konradu za njegov odgovor. Ovo je područje istraživanja u kojem smo angažirani ja i kolege. Iskreno, lakše je procijeniti promjene u mikrobiomu na temelju prehrane, a ne gledati u fekalni materijal kako bi se utvrdila (neiskorištena) metabolička energija ili potencijal s obzirom na određeni unos (tj. Iz kontrolirane prehrane).

Nedavno smo ljude hranili velikim brojem porcija integralnih žitarica. Odgovor je vrlo individualistički s nekim padovima, a s drugim povećanjem u Firmicutesu, na primjer. Obično se brojevi Bacteroidetes kreću suprotno od Firmicutesa, ali ne kod svih pojedinaca. Ova zapažanja vide i drugi u ovom rastućem području istraživanja.

Rad o "enterotipovima" koji Konrad citira počinje uočavati otpor u ovoj oblasti u tome što tri enterotipa koja su definirali ti autori zapravo nisu tako jasno definirana kada se bolje pogleda više pojedinaca. Vrijeme će pokazati koliko se dobro drži jedan ili drugi stav.


Prehrana za precizno zdravlje, pokrenuta istraživačkim programom Svi mi

Cilj NIH Common Food’s Nutrition for Precision Health, pokreće Svi mi Program istraživanja, je razvoj algoritama koji predviđaju individualne odgovore na hranu i obrasce ishrane. Ishrana igra integralnu ulogu u ljudskom razvoju i u prevenciji i liječenju bolesti. Međutim, ne postoji savršena dijeta koja bi odgovarala svima. NPH program će se nadograđivati ​​na nedavna dostignuća u biomedicinskoj znanosti, uključujući umjetnu inteligenciju (AI), istraživanje mikrobioma, kao i na infrastrukturu i veliku, raznoliku grupu učesnika Svi mi Program istraživanja. Ovaj napredak pruža neviđene prilike za stvaranje novih podataka kako bi se pružio uvid u personaliziranu ishranu koja se također naziva precizna prehrana.
Osim toga, prvi strateški plan za istraživanje ishrane NIH-a naglasio je mogućnosti za poboljšanje našeg razumijevanja kako individualna ljudska biologija i molekularni putevi utječu na odnose između prehrane i okolišnih, društvenih i bihevioralnih faktora koji utiču na zdravlje. Osmišljen za implementaciju aspekata Strateškog plana, program Ishrana za precizno zdravlje sprovešće studiju ugniježđenu u Svi mi Istraživački program za istraživanje kako pojedinci reaguju na različite dijete. NPH studija je prva pomoćna studija koja koristi Svi mi infrastrukturu za odgovore na naučna pitanja važna za učesnike, poput boljeg razumijevanja uloge ishrane u zdravlju. Visokokvalitetne studije prehrane, poput NPH studije, pomoći će pojedincima i njihovim zdravstvenim radnicima u stvaranju zdravih, preciznih i učinkovitih planova prehrane.

Ciljevi studije su:
1. Ispitati individualne razlike uočene kao odgovor na različite dijete proučavajući interakcije između prehrane, gena, proteina, mikrobioma, metabolizma i drugih pojedinačnih kontekstualnih faktora
2. Koristiti umjetnu inteligenciju (AI) za razvoj algoritama za predviđanje individualnih odgovora na hranu i prehrambene obrasce
3. Potvrditi algoritme za kliničku primjenu

Program Nutrition for Precision Health uključuje nekoliko integriranih komponenti:

1) Centar za koordinaciju istraživanja: Omogućite administrativno upravljanje i koordinaciju na svim web lokacijama.
2) Klinički centri: Regrutirajte, pristanite i upišite sve nas učesnike u ishranu
program.
3) Centri za generiranje podataka: a) Izvršiti genetske analize mikrobioma iz ljudskog crijeva b) Izvršiti metaboličke analize c) Unaprijediti metode procjene ishrane.
4) Centar za umjetnu inteligenciju, multimodalno modeliranje podataka i bioinformatiku: Uspostaviti matematičko i računsko modeliranje, razviti algoritme i poboljšati vizualizaciju podataka.
5) Svi mi Biobanka: Primajte, obrađujte i skladištite biološke uzorke i metapodatke.


Thryve personalizirani probiotici

Klinička i naučna istraživanja za naše formulacije sojeva

Naša formula imunološkog zdravlja sadrži Lactobacillus paracasei Th1 i Th2. L. paracasei Th1 se takođe naziva LP33, Th2 se naziva AAP-2. Nekoliko kliničkih studija pokazalo je da oni mogu modulirati imunološki sistem ublažavanjem simptoma alergijskog rinitisa i atopijskog dermatitisa (Ref 1, Ref 2, Ref 3). Osim toga, naša formulacija za kontrolu težine sadrži Lactobacillus reuteri Tr1, koji se također naziva L. ruteri ADR1. Ovaj patentirani probiotički soj može modulirati metaboličko zdravlje, pomoći u kontroli tjelesne težine (ref 4, Ref 5), a trenutno je pod kliničkim ispitivanjem 2017-2018 na (Ref 6).

Naša formulacija za zdravlje probave sadrži vrste Bacillus, Lactobacillus i Bifidobacterium, sastojke koji potiču iz biljaka, ljudi i mliječnih proizvoda. Ne sadrže gluten i kapsulirani su u biljnoj celulozi, koja pomaže zaobići želučanu kiselinu.


Crijevni mikrobiom uključen u zdravo starenje i dugovječnost

Mikrobiom crijeva je sastavni dio tijela, ali njegova važnost u procesu starenja čovjeka je nejasna. Istraživači ISB -a i njihovi suradnici identificirali su različite potpise u crijevnom mikrobiomu koji su povezani sa zdravim ili nezdravim putanjama starenja, što zauzvrat predviđa preživljavanje u populaciji starijih osoba. Rad će biti objavljen u časopisu Metabolizam prirode.

Istraživački tim analizirao je mikrobiom crijeva, fenotipske i kliničke podatke od preko 9.000 ljudi - u dobi od 18 do 101 godine - u tri nezavisne kohorte. Tim se posebno usredotočio na longitudinalne podatke iz kohorte od preko 900 starijih osoba koje žive u zajednici (78-98 godina), omogućavajući im da prate ishode zdravlja i preživljavanja.

Podaci su pokazali da su crijevni mikrobiomi postajali sve jedinstveniji (tj. Sve se više razlikovali od drugih) kao pojedinci u dobi, počevši od sredine do kasne odrasle dobi, što je odgovaralo stalnom smanjenju obilja osnovnih bakterijskih rodova (npr. Bacteroides) koji su obično podijeljeno među ljudima.

Zapanjujuće je da dok su mikrobiomi postajali sve jedinstveniji za svakog pojedinca u zdravom starenju, metaboličke funkcije koje su mikrobiomi obavljali dijele zajedničke osobine. Ovaj potpis jedinstvenosti crijeva bio je u velikoj korelaciji s nekoliko metabolita dobivenih mikrobima u krvnoj plazmi, uključujući jedan-indol izveden iz triptofana-za koji se ranije pokazalo da produžava životni vijek kod miševa. Koncentracija drugog metabolita u krvi - fenilacetilglutamina - pokazala je najjaču povezanost s jedinstvenošću, a prethodni radovi su pokazali da je ovaj metabolit zaista visoko povišen u krvi stogodišnjaka.

"Ovaj jedinstveni potpis može predvidjeti preživljavanje pacijenata u posljednjim decenijama života", rekao je naučnik ISB -a dr Tomasz Wilmanski, koji je vodio studiju. Zdravi pojedinci stari oko 80 godina pokazali su kontinuirani mikrobni pomak prema jedinstvenom sastavnom stanju, ali taj pomak nije bio prisutan kod manje zdravih osoba.

"Zanimljivo je da se čini da ovaj obrazac jedinstvenosti počinje u sredini života - 40-50 godina - i povezan je s jasnim metabolomskim potpisom u krvi, što sugerira da ove promjene mikrobioma ne moraju biti samo dijagnostika zdravog starenja, već da mogu takođe doprinose zdravlju kako starimo ", rekao je Wilmanski. Na primjer, poznato je da indoli smanjuju upalu u crijevima, a smatra se da je kronična upala glavni pokretač u progresiji oboljenja povezanih sa starenjem.

"Prethodni rezultati istraživanja starenja mikrobioma izgledaju nedosljedno, s nekim izvještajima koji pokazuju pad osnovnih rodova crijeva u stogodišnjim populacijama, dok drugi pokazuju relativnu stabilnost mikrobioma sve do početka opadanja zdravlja povezanog sa starenjem", rekao je specijalista za mikrobiom dr. Sean Gibbons, ko-odgovarajući autor rada. "Naš rad, koji je prvi koji uključuje detaljnu analizu zdravlja i preživljavanja, mogao bi riješiti ove nedosljednosti. Konkretno, pokazujemo dvije različite starosne putanje: 1) smanjenje jezgre mikroba i prateći porast jedinstvenosti kod zdravijih osoba, dosljedan sa prethodnim rezultatima kod stogodišnjaka koji žive u zajednici, i 2) održavanje jezgra mikroba kod manje zdravih osoba."

Ova analiza naglašava činjenicu da se mikrobiom crijeva odrasle osobe nastavlja razvijati s poodmaklom dobi kod zdravih osoba, ali ne i kod nezdravih, te da sastav mikrobioma povezan sa zdravljem u ranoj i srednjoj odrasloj dobi možda nije kompatibilan sa zdravljem u kasnoj odrasloj dobi.

"Ovo je uzbudljivo djelo za koje mislimo da će imati velike kliničke implikacije za praćenje i promjenu zdravlja crijevnih mikrobioma tokom života osobe", rekao je profesor ISB-a dr. Nathan Price, ko-odgovarajući autor rada.

Ovaj istraživački projekt proveli su ISB i suradnici sa Oregonskog zdravstvenog i naučnog univerziteta, Kalifornijskog univerziteta San Diego, Univerziteta u Pittsburghu, Kalifornijskog univerziteta Davis, Instituta za medicinu stila života i Univerziteta Washington. Djelomično je podržan od strane Nagrade Catalyst za zdravu dugovječnost Nacionalne medicinske akademije i Konzorcijuma za dugovječnost Nacionalnog instituta za starenje.


Utjecaj nedonoščadi i ishrane na mikrobiom crijeva u razvoju i rast prijevremeno rođene djece

Pozadina: Hitno je potrebna identifikacija faktora koji utječu na mikrobiom neonatalnog crijeva kako bi se vodila klinička praksa koja podržava rast zdrave nedonoščadi. Ovdje smo ispitali utjecaj prehrane i uobičajenih praksi na crijevnu mikrobiotu i rast u skupini nedonoščadi.

Rezultati: Sa nedeljnim uzorcima crevne mikrobiote koji obuhvataju postmenstrualnu dob (PMA) od 24 do 46 nedelja, razvili smo dva modela za testiranje povezanosti između mikrobiote, ishrane i rasta: kategorički model sa tri uzastopne faze mikrobiote (P1, P2 i P3) i model sa dva perioda (rani i kasni PMA) definisan sastavom mikrobiote i PMA, respektivno. Značajnije asocijacije na fazu navele su nas da koristimo fazni okvir za većinu naših analiza. Fazne prijelaze karakteriziraju brzi pomaci u mikrobioti, pri čemu se prelazak iz P1 događa gotovo istodobno s promjenom iz mekonija u normalnu stolicu. Stopa progresije faze bila je pozitivno povezana s gestacijskom dobi pri rođenju, a odgođeni prijelaz na P3 mikrobiotu bio je povezan s neuspjehom rasta. Našli smo različite metaboličke funkcije bakterija u P1-3 i značajnu povezanost između prehrane, faze mikrobiote i rasta dojenčadi.

Zaključak: Utjecaj prehrane ovisan o fazi, zajedno s metaboličkim funkcijama specifičnim za fazu, sugerira pionirski potencijal za poboljšanje ishoda rasta prilagođavanjem unosa hranjivih tvari fazi mikrobiote.

Ključne riječi: Mikrobiota crijeva Rast dojenčadi Mekonij Prehrana Fazna tranzicija Prijevremeno rođena djeca.

Izjava o sukobu interesa

Etičko odobrenje i pristanak za učešće

Pisani informirani pristanak pribavljen je od roditelja ili staratelja sve uključene djece. Institucionalni odbor za reviziju na Medicinskom fakultetu Univerziteta u Rochesteru i Strong Memorial Hospital odobrio je studiju.

Pristanak za objavljivanje
Konkurentni interesi

Autori izjavljuju da nemaju suprotstavljene interese.

Napomena izdavača

Springer Nature ostaje neutralna u pogledu zahtjeva za nadležnost u objavljenim mapama i institucionalnih veza.

Figure

Pregled nedonoščadi…

Pregled faza i svojstava crijevne mikrobiote nedonoščadi. a Odluka…

Vremenska distribucija crijevne mikrobiote…

Vremenska raspodjela faza mikrobiote crijeva, promjena u težini novorođenčadi i klirens mekonija.


Trenutne prakse procjene ishrane i njihova ograničenja u studijama dijetetskih mikrobioma

Pojava i sve veća dostupnost i pristupačnost tehnologije sekvenciranja rezultirala je eksplozijom literature o dijetalnim mikrobiomima. To se lako ilustrira PubMed pretraživanjem 𠇍iet ” i “mikrobioma. ” U 2009. objavljeno je 100 radova, a u 2019. objavljeno je 2.204 rada koji su identificirani pomoću ovih pojmova za pretraživanje. Od januara 2020. godine, 9.544 rada je vraćeno na PubMed pod ovim uslovima, a od toga je više od polovine objavljeno u posljednje 3 godine. Ovo povećanje publikacija popraćeno je sve većom sviješću o ograničenjima s kojima se suočavamo pokušavajući mjeriti i analizirati vrlo složene interakcije između mikroba, izloženost u ishrani i fenotipove domaćina.

Mjerenje unosa hranom ostaje posebno izazovno. Iako su se metode prikupljanja i analize podataka o mikrobiomima poboljšale u proteklom desetljeću, došlo je do malih promjena u analizi i prikupljanju podataka o prehrani u mnogim studijama na ljudima oslanjajući se na upitnike o učestalosti hrane (FFQ) ili evidenciju jednodnevne hrane koju su sami dali ili 24-časovni opoziv dijete. Svaka od ovih metoda je sklona prijavljivanju grešaka i povezana je s prednostima i nedostacima, kao što je opsežno pregledano drugdje (35). Važno je da, iako određeni pristupi procjeni ishrane mogu biti adekvatni za procjenu ukupnog kalorijskog unosa, raznolikosti ishrane ili unosa određenih namirnica i kategorija hrane, možda neće obuhvatiti nivo detalja koji je potreban za otkrivanje odnosa između prehrane i crijevnog mikrobioma. Iako su poboljšane metode prikupljanja i procjene ishrane u studijama mikrobioma očajnički potrebne za rješavanje ovih pitanja, razvoj i usvajanje novih tehnika procjene ishrane će potrajati. U međuvremenu se preporučuje pažljivo razmatranje ključnih varijabli pri planiranju studija i integriranju podataka o prehrani s rezultatima mikrobioma.

Precizno mjerenje i procjena unosa hrane pomoću samoizvještaja i nutritivnih biomarkera je izazov (36, 37). Prilikom odabira tehnike procjene ishrane za studiju mikrobioma, odabrana metoda će u konačnici utjecati na istraživačka pitanja na koja se može odgovoriti korištenjem podataka. Kao i većina istraživačkih odluka, za procjenu prehrane potrebno je odmjeriti konkurentne mogućnosti u smislu vremena, kvalitete i cijene. U ovom slučaju, vrijeme uključuje i vrijeme istražitelja za prikupljanje i pregled, te vrijeme odgovora učesnika i opterećenje zbog napora uloženog u snimanje dijete. Na vrijeme učesnika utiče vremenski okvir vođenja evidencije o ishrani. Procjene ishrane s malim opterećenjem uključuju administraciju jednog 24-časovnog opoziva ili zapisa ili jednog FFQ-a za prikupljanje istorije ishrane tokom prethodnih sedmica, mjeseci ili godina. Dugotrajne longitudinalne procjene ishrane, korišćenje detaljnih dnevnih evidencija tokom dužeg perioda od sedmica, mjeseci ili čak godina, imaju veliki teret za učesnike. Kvaliteta se odnosi na to koliko podaci iz procjene ishrane točno bilježe i odražavaju stvarni unos hrane, te koliko dobro podaci obuhvaćaju razinu detalja neophodnu za ishode povezane s mikrobiomima, poput uključivanja mikrobiološki važnih kemikalija dobivenih ishranom u baze podataka o hranjivim tvarima. (38). Troškovi su također višefaktorski, uključujući troškove bilo kojeg nutritivnog softvera ili uređaja za prikupljanje fizičkih mjerenja, poput vaga i mjernih čaša, na troškove obučenog osoblja za prikupljanje ili unošenje dnevnih opoziva 24 sata dnevno, kao i na troškove potrebne za plaćanje učesnika radi poticanja učešća i kompletno vođenje evidencije. Obično istraživači mogu odabrati samo dva od ova tri konkurentna interesa—vrijeme, kvalitet ili trošak. Stoga istraživači obično odlučuju da minimiziraju vremensko opterećenje učesnika i ukupne troškove nauštrb kvaliteta. Ono što to znači u praksi je da istraživački timovi često koriste FFQ-e ili dijetetske skrininge umjesto vremenski intenzivnijih i troškovno intenzivnijih metoda poput višednevnih zapisa o ishrani ili opoziva koje vodi obučeno osoblje.

Mjerenje ishrane pomoću FFQ ima i prednosti i nedostatke (39, 40). Primarna prednost je što su FFQ -i prikladni. Vrlo ih je lako administrirati i oduzimaju manje vremena učesnicima od drugih metoda. Učesnik studije jednostavno naznači učestalost kojom konzumira određenu hranu i koliko je konzumira, a ti odgovori se koriste za procjenu ukupnog kalorijskog unosa, kao i unosa glavnih makronutrijenata i mikronutrijenata. Međutim, budući da su FFQ -ovi razvijeni za kvantificiranje širokih obrazaca prehrane ili indeksa zdrave prehrane, oni su ograničeni na brojne načine i ne mogu obuhvatiti prehranu jednako precizno kao druge metode (41). Iako su daleko od optimalnih, obrasci ishrane koje je procijenio FFQ dali su uvid u način na koji uobičajena prehrana doprinosi sastavu mikrobioma, dugoročni unos hranjivih tvari određen FFQ-om povezan je sa sastavom mikroba, te utvrđenim odnosima između obrazaca ishrane određenih FFQ-om i obilja mikrobnih rodova (7, 42�). Ovi su nalazi potkrijepljeni istraživanjima koja pokazuju da promjena prehrambenih obrazaca, eksperimentalno ili putem prirodnih eksperimenata koji koriste sezonske prehrambene navike ili imigraciju, utječe na sastav mikrobioma (45 �). Međutim, većina FFQ -a nije osmišljena da pruži podatke koji mogu povezati specifičnu hranu sa specifičnim promjenama u sastavu mikrobnih vrsta ili funkcionalnim putevima.

Unatoč identifikaciji nekih signala iz studija mikrobioma koje koriste FFQ za analizu ishrane, tehnika jednostavno nije dovoljno specifična da razmrsi složene odnose između hrane i mikrobioma. Ranije smo pokazali da sastav mikrobioma bliže odgovara unosu hrane, a ne unosu hranjivih tvari (6), što ukazuje na to da je oslanjanje na postojeće varijable sastava hranjivih tvari nedovoljno i da su same hrane važne pri istraživanju korijacije ishrane i mikrobioma. Međutim, čak i dobro provedeno 24-satno povlačenje i evidencija hrane ne uspijevaju dovoljno obuhvatiti složenost hrane na načine koji su značajni za mikrobe. Na primjer, jedna marka kruha može uključivati ​​7 različitih cjelovitih žitarica, kao i orahe i sjemenke, dok se druga marka može napraviti od proklijale pšenice. Tokom ulaska u dijetu oba ova kruha mogu biti šifrirana kao kruh od cjelovitog zrna i stoga će ih analiza u nastavku tretirati kao identične kada su različiti. Ova varijacija mogla bi doprinijeti nekim od personaliziranih rezultata ishrane-mikrobioma koji su prijavljeni u vezi s odgovorom glukoze u krvi (16, 19).

U slučajevima kada istraživači prepoznaju potrebu prikupljanja preciznijih podataka o prehrani, u literaturi o mikrobiomima uobičajeno je čitati o tehnikama koje koriste upitnike o hrani koje su razvili istraživači, neovisno stvorene metode prikupljanja zasnovane na aplikacijama (16, 48) i potrošačima- suočavanje sa alatima za analizu hranjivih tvari umjesto korištenja potvrđenih tehnika za prikupljanje hrane ili alata za analizu hranjivih tvari razvijenih s fokusom istraživanja (23). Prilikom prikupljanja opoziva 24 sata ili traženja od sudionika evidencije hrane 24 sata, uključivanje odgovarajuće obučenog osoblja može poboljšati kvalitetu podataka. Učesnici koji bilježe svoj unos u najmanju ruku bi trebali biti obučeni koristeći detaljne primjere koji pokazuju nivo detalja neophodan za kompletiranje tačne evidencije. To bi trebalo uključivati ​​raspravu o veličini posluživanja, specifičnosti sastojaka, metodama pripreme i uključivanju često zaboravljene hrane i aditiva. Sve zapise treba pregledati sa učesnikom sa fokusom na identifikaciju pogrešno prijavljene ili često zaboravljene hrane. Metode za procjenu unosa hrane se poboljšavaju, a tehnologija pomoću kompjuteriziranih opoziva i evidencija može uvelike smanjiti opterećenje istraživača pri prikupljanju podataka o prehrani. Bez obzira na metodu prikupljanja, kada su zapisi ili opozivi kodirani za analizu pomoću softvera za istraživanje ishrane, važno je uzeti u obzir konzistentnost sa unosom podataka, kodiranjem i čišćenjem podataka o ishrani kako bi se omogućila robusna analiza sastava nutrijenata i unosa hrane nizvodno.

U trenutnom okruženju prikupljanja zapisa o ishrani, različiti alati za prikupljanje ishrane i FFQ-ovi se oslanjaju na različite osnovne baze podataka, što čini poređenje među studijama i kohortama teškim, ako ne i gotovo nemogućim. Čak i unutar regiona Amerike, Ujedinjenog Kraljevstva i Australije, koji govore engleski, podaci o hrani se na kraju mapiraju u različite baze podataka u zavisnosti od softverskih alata koji se koriste za analizu (49). Svaka baza podataka pruža podatke o sastavu nutrijenata, ali izvor tih podataka varira. Metode analize za određene hranjive tvari također se mogu razlikovati ovisno o bazi podataka, što dovodi do različitih ishoda na razini hranjivih tvari u bazama podataka iz različitih zemalja. Osim sastava hranjivih tvari, konvencije imenovanja koje se koriste za identifikaciju hrane nisu identične u svim bazama podataka što dovodi do problema pri usporedbi podataka prikupljenih različitim alatima. Osim toga, strukture grupiranja hrane variraju, bez univerzalno prihvaćene metode usvojene u studijama ili bazama podataka. Napori da se uspostavi zajednička ontologija hrane koja može uskladiti podatke o ishrani prikupljene u različitim globalnim regijama i različitim alatima su u toku, uključujući i druge karakteristike hrane kao što je način pripreme (50). Priprema hrane i metode kuhanja mijenjaju kemijska svojstva namirnica, poput promjena koje se događaju slatkom krumpiru tokom kuhanja, a koje zatim utječu na učinke te hrane na mikrobiom (51), dodajući još jedan sloj složenosti mjerenju prehrane. Matrica hrane (52) će vjerojatno igrati važnu ulogu u odnosu između prehrane i mikrobioma, pa je također potrebno uzeti u obzir. Određeni podaci, kao što je zrelost plodova, trenutno se ne bilježe u bilo kojoj bazi podataka o hrani. Međutim, ovaj nivo detalja može biti vrlo relevantan za određene interakcije hrane i mikroba. Na primjer, poznato je da kada su banane nezrele ili zelene, škrob koji se nalazi u njima je otporan škrob (53), koji je fermentiran od strane mikroba, dok se u zrelim bananama taj otporni škrob razgradio na jednostavnije molekule škroba i glukoze, koji su može se apsorbirati od strane domaćina i više ne pruža fermentabilnu podlogu za crijevne mikrobe. Osim pripreme hrane i zrelosti, nedavna istraživanja koja se bave prehrambenim ponašanjem u vezi s ultra prerađenom hranom pokazuju da samo kontrola energije i sadržaja makronutrijenata može biti nedovoljna za dijetetske intervencije (54). Dobavljanje hrane, metode prerade ili kuhanja (51), aditivi ili emulgatori (55, 56), umjetni zaslađivači (57) i konvencionalne ili organske metode uzgoja (58) vjerovatno također moraju biti uzete u obzir.

Osim promjena u mikrobiomu uzrokovanih biohemijskim komponentama hrane, sama hrana sadrži bakterije koje utiču na mikrobiom crijeva. Sa zdravstvene perspektive, fermentirani mliječni proizvodi, poput jogurta i sireva, najčešće su prepoznata hrana koja sadrži �nosne ” mikrobe (59). Ove namirnice su izvori mikroba koji prolazno mogu naseliti crijeva čovjeka (23). Svježa, nefermentirana hrana odavno je prepoznata kao izvor patogena koji se prenose hranom i meta su javnozdravstvenih intervencija kako bi se spriječilo širenje bolesti prenosivih hranom. Unatoč tom priznanju, iznenađujuće malo znamo o sastavu mikroba u drugim nefermentiranim namirnicama. Nedavno se pokazalo da usjevi za koje se obično ne smatra da prenose bakterije, kao što su jabuke, imaju mikrobiom koji ovisi o rastu i poljoprivrednim praksama (58). Zaista, obrasci ishrane koji uključuju više vrsta hrane, posebno fermentisanu hranu kao što je jogurt, sadrže veću količinu mikroba u odnosu na manje raznoliku ishranu (1 × 10 9 jedinica koje formiraju kolonije [CFU] naspram 1 × 10 6 CFU u dnevne obroke u vrijednosti od#x00027) (60). Uzimanje u obzir mikrobnog opterećenja prehrambenog obrasca važno je jer unos nepatogenih bakterija koje se prenose hranom djelomično ovisi o drugim dijetalnim komponentama. Na primjer, veće količine bakterija povezanih sa parmezanom i sirom su prisutne nakon konzumiranja mliječnih proizvoda (61). U idealnom slučaju, trebamo uzeti u obzir ove mikrobne karakteristike ishrane kada planiramo i analiziramo studije mikrobiomske ishrane.


Napredne tehnologije za prepoznavanje imidža hrane u procjeni unosa hranjivih tvari

Procjena ishrane je ključni korak u stvarnoj primjeni bilo kojeg personaliziranog programa ishrane. Sposobnost pojedinca da prati unos hrane igra ulogu u samokontroli kao kritični aspekt promjene ponašanja (referenca Peterson, Middleton i Nackers 88). Također može pružiti profesionalnom dijetetičaru informacije o tome kako se klijent pridržava svog individualiziranog plana obroka. Međutim, procjena unosa hranom tradicionalnim metodama nosi znatne troškove i teret za pojedinca. Takve metode su također sklone greškama jer se često oslanjaju na samoizvještavanje (Reference Burrows, Ho i Rollo 89).

Potrebna su napredna rješenja za objektivnu kvantifikaciju unosa hrane i pića (Reference Mezgec, Eftimov i Bucher 90). Prepoznavanje slike hrane je obećavajuća strategija jer većina pojedinaca posjeduje pametni telefon s kamerom, tako da je barijera za ulazak niska i može doseći veliku populaciju. Međutim, automatsko prepoznavanje namirnica po slikama izazov je problem računarskog vida zbog različitih problema: (1) hrana je tipično predmet deformacije, (2) hrana može izgubiti vizualne informacije tijekom pripreme, (3) različita hrana može se vizualno pojaviti slično, (4) ista hrana može izgledati različito ovisno o osvjetljenju ili kutu i (5) ograničena količina vizualnih informacija za pića (Referenca Mezgec i Koroušić Seljak 91). Tek nakon što se namirnice vizualno prepoznaju, mogu se pouzdano povezati s bazom podataka o sastavu hrane (Referenca Eftimov, Korošec i Koroušić Seljak 92).

Uvođenje Pittsburgh Fast-Food Image Dataset 2009. godine olakšalo je rano istraživanje u ovoj oblasti zasnovano na metodama ručnog prepoznavanja, ali su ovi pristupi uglavnom postigli samo 10-40% preciznosti klasifikacije (Reference Chen, Dhingra i Wu 93, Reference Yang, Chen i Pomerleau 94). Godine 2014. duboko je učenje prvi put korišteno za prepoznavanje slika hrane. Duboko učenje ili duboke neuronske mreže dopuštaju računskim modelima sastavljenim od više slojeva obrade da nauče relevantne karakteristike slike kroz obuku na skupu ulaznih slika (Reference LeCun, Bengio i Hinton 95, Reference Deng i Yu 96). Duboke konvolucione neuronske mreže inspirisane su vizuelnim sistemom životinja, gdje pojedinačni neuroni procjenjuju vizuelni ulaz reagirajući na preklapajuća područja u vidnom polju (Reference Hubel i Wiesel 97). Budući da mogu klasificirati svaki piksel slike, mogu prepoznati bilo koji broj stavki, zajedno s njihovom lokacijom i veličinom, što omogućava procjenu količine hrane i težine hrane. Ovaj pristup je postigao znatno bolje rezultate od drugih metoda, što je rezultiralo povećanim fokusom na dublje učenje u nedavnom istraživanju (Reference Zhou, Zhang i Liu 98, Reference Knez i Šajn 99).

Mezgec i Koroušić Seljak razvili su novu arhitekturu dubokog učenja za prepoznavanje slike hrane, pod nazivom NutriNet (Referenca Mezgec i Koroušić Seljak 91). To je modifikacija poznate AlexNet arhitekture (Reference Krizhevsky, Sutskever, Hinton, Pereira, Burges i Bottou 100), s povećanom veličinom slike i dodatnim konvolucijskim slojem na početku neuronske mreže (Reference Mezgec i Koroušić Seljak 91 ) . NutriNet je prvi put obučen na 225 953 slobodno dostupnih slika koje su preuzete s interneta i organizirane u odgovarajuće klase hrane (520 jedinstvenih namirnica). Kada se testira na tri popularne arhitekture dubokog učenja tog vremena (AlexNet (Reference Krizhevsky, Sutskever, Hinton, Pereira, Burges i Bottou 100), GoogLeNet (Reference Szegedy, Wei i Yangqing 101) i ResNet (Reference He, Zhang i Ren 102) ), utvrđeno je da je NutriNet superiorniji u odnosu na AlexNet i GoogLeNet i brži za obuku od sve tri druge arhitekture. Pristup dubokog učenja tada je upotrijebljen za prepoznavanje bilo kojeg broja artikala u jednoj slici hrane pomoću seta za obuku dobivenog iz „bifea s lažnom hranom“ (Reference Bucher, van der Horst i Siegrist 103), koji je vizualno sličan pravoj hrani. Potpuno konvolucione mreže, koje je uveo Long et al. (Reference Long, Shelhamer i Darrell 104), primijenjene su za izvođenje semantičke segmentacije, podjelu slike na logičke dijelove i klasifikaciju svakog dijela na nivou piksela. Zbog složenosti slika hrane, potpuno konvoluciona mrežna varijanta koja može segmentirati slike sa najfinijim zrnom (potpuno konvoluciona mreža-8s) (Reference Long, Shelhamer i Darrell 104) korištena je za obuku modela na lažnim podacima o slikama iz švedskog stola set. Output predictions of the trained model were compared with the ground-truth labels using the pixel accuracy measure ( Reference Long, Shelhamer and Darrell 104) , and the final accuracy of the trained fully convolutional network-8s model was 92·18 %.

In recent years, deep learning has been validated numerous times as a suitable solution for recognising food images ( Reference Zhou, Zhang and Liu 98) . Availability of food image data sets has been improving ( Reference Ciocca, Napoletano and Schettini 105– Reference Cai, Li and Li 107) , although there is a need for validation against data sets from different regions across the world. Future work will focus on real-world food images, which exhibit more variance compared with the test images used in the research environment. In the future, such technology could be used to improve dietary assessment in clinical trials. For example, it can play a role in human studies in the areas mentioned above, where accurate quantification of folate, vitamin B12 and energetic intake is critical. Consumer wellness apps can also apply this solution in the future, improving the dietary assessment of individuals and facilitating self-monitoring towards positive behaviour change.


Genetics or lifestyle: What is it that shapes our microbiome?

The question of nature vs nurture extends to our microbiome -- the personal complement of mostly-friendly bacteria we carry around with us. Study after study has found that our microbiome affects nearly every aspect of our health and its microbial composition, which varies from individual to individual, may hold the key to everything from weight gain to moods. Some microbiome researchers had suggested that this variation begins with differences in our genes but a large-scale study conducted at the Weizmann Institute of Science challenges this idea and provides evidence that the connection between microbiome and health may be even more important than we thought.

Indeed, the working hypothesis has been that genetics plays a major role in determining microbiome variation among people. According to this view, our genes determine the environment our microbiome occupies, and each particular environment allows certain bacterial strains to thrive. However, the Weizmann researchers were surprised to discover that the host's genetics play a very minor role in determining microbiome composition -- only accounting for about 2% of the variation between populations.

The research was led by research students Daphna Rothschild, Dr. Omer Weissbrod and Dr. Elad Barkan from the lab of Prof. Eran Segal of the Computer Science and Applied Mathematics Department, together with members of Prof. Eran Elinav's group of the Immunology Department, all at the Weizmann Institute of Science. Their findings, which were recently published in Priroda, were based on a unique database of around 1,000 Israelis who had participated in a longitudinal study of personalized nutrition. Israel has a highly diverse population, which presents an ideal experimental setting for investigating the effects of genetic differences. In addition to genetic data and microbiome composition, the information collected for each study participant included dietary habits, lifestyle, medications and additional measurements. The scientists analyzing this data concluded that diet and lifestyle are by far the most dominant factors shaping our microbiome composition.

If microbiome populations are not shaped by our genetics, how do they nonetheless interact with our genes to modify our health? The scientists investigated the connections between microbiome and the measurements in the database of cholesterol, weight, blood glucose levels, and other clinical parameters. The study results were very surprising: For most of these clinical measures, the association with bacterial genomes was at least as strong, and in some cases stronger, than the association with the host's human genome.

According to the scientists, these findings provide solid evidence that understanding the factors that shape our microbiome may be key to understanding and treating many common health problems.

Segal: "We cannot change our genes, but we now know that we can affect -- and even reshape -- the composition of the different kinds of bacteria we host in our bodies. So the findings of our research are quite hopeful they suggest that our microbiome could be a powerful means for improving our health."

The field of microbiome research is relatively young the database of 1,000 individuals collected at the Weizmann institute is one of the most extensive in the world. Segal and Elinav believe that over time, with the further addition of data to their study and those of others, these recent findings may be further validated, and the connection between our microbiome, our genetics and our health will become clearer.


This is an excerpt from Environmental Microbiology Reports, 2015, authored by Arjun Raman, a postdoc in the Baliga Lab here at Institute for Systems Biology. The beauty of a living thing is not the atoms that go into it, but the way those atoms are put together. Information distilled over four billion years of biological evolution. Incidentally, all the organisms on the Earth are made essentially of that stuff. An…


Metode

Clinical methods

All study procedures were approved by the University of Rochester School of Medicine Internal Review Board (IRB) (Protocol # 37933). Infants included in the study were from the multicenter Prematurity and Respiratory Outcomes Program (PROP) and the Respiratory Pathogens Research Center (RPRC) at the University of Rochester School of Medicine and were cared for in a single-center Newborn Intensive Care Unit (NICU). Clinical care in terms of type and duration of antibiotic treatment, corticosteroids, diuretics, motility agents, and H2 receptor agonists as well as the timing and volume of feeds was at the discretion of treating physicians. Rectal swabs were used to collect fecal material from consented infants from 24 PMA until discharge and again at 6 months and 1 year for preterms and birth and 1 month for full terms. Each sample was collected by inserting a sterile Copan flocked nylon swab (Copan Diagnostics, Murrieta, CA) moistened with normal saline beyond the sphincters into the rectum and then twirled. Each sample was immediately placed into sterile buffered saline and stored at 4 °C for no more than 4 h. Samples were processed daily, which involved extraction of the fecal material from the swab in a sterile environment and immediately frozen at − 80 °C until DNA extraction. All sampling swabs, plasticware, buffers, and reagents used for sample collection and extraction of nucleic acids were sterile and UV-irradiated to insure no contamination from sources outside of the infant and sample.

Derived medication and nutrition variables

For all medications considered, binary variables were derived for each sample that indicate whether or not a given medication was administered in the week (7 days) prior to sample collection. Weight Z-score was computed as a proxy for growth. First, weight percentile was computed as the percentage of weight measures of a population of the same sex and age that fall below the observed weight value. We applied Cole’s LMS method as used by CDC and WHO [54]. The standard growth chart is based on sex-matched premature infant population weight data collected by Fenton and Kim [55, 56]. Weight Z-scores were computed based on the corresponding weight percentiles. Four variables associated with each sample were derived for nutritional intake: total calories per kilogram in the week prior to sample collection, ratio of lipids or proteins in the week prior to sample collection, and the ratio of total calories in the week prior to sample collection that were consumed enterally (as opposed to parenterally). These values were computed based on detailed daily feeding records and the available nutrition facts for all formulas, supplements, and total parenteral nutrient preparations used in the NICU. Total calories per kilogram in the past week is the sum of total calories per kilogram per day for the 7 days prior to sampling. The proportion of enteral calories computed as the ratio of (grams of lipids/protein per kilogram) divided by (total calories per kilogram) for each day, summed over the 7 days prior to sampling. “Enteral calorie ratio past week” was computed as the total calories per kilogram consumed enterally in the week prior to sampling divided by the total calories per kilogram consumed (enterally and parenterally) in the same period.

Genomic DNA extraction

Total genomic DNA was extracted with a modified method using the QIAGEN Fecal DNA kit and FastPrep mechanical lysis (MPBio, Solon, OH). 16S ribosomal RNA (rRNA) was amplified with Phusion High-Fidelity polymerase (Thermo Scientific, Waltham, MA) and dual indexed primers specific to the V3-V4 hypervariable regions (319F: 5′ ACTCCTACGGGAGGCAGCAG 3′ 806R: 3′ ACTCCTACGGGAGGCAGCAG 5′) [57]. Amplicons were pooled and paired-end sequenced on an Illumina MiSeq (Illumina, San Diego, CA) in the University of Rochester Genomics Research Center. Each sequencing run included (1) positive controls consisting of a 1:5 mixture of Staphylococcus aureus, Lactococcus lactis, Porphyromonas gingivalis, Streptococcus mutans, i Escherichia coli and (2) negative controls consisting of sterile saline.

16S rRNA sequence processing

Raw data from the Illumina MiSeq was first converted into FASTQ format 2 × 300 paired-end sequence files using the bcl2fastq program, version 1.8.4, provided by Illumina. Format conversion was performed without de-multiplexing and the EAMMS algorithm was disabled. All other settings were default. Sequence processing and microbial composition analysis were performed with the Quantitative Insights into Microbial Ecology (QIIME) software package [58], version 1.9. Reads were multiplexed using a configuration described previously [57]. Briefly, for both reads in a pair, the first 12 bases were a barcode, which was followed by a primer, then a heterogeneity spacer, and then the target 16S rRNA sequence. Using a custom Python script, the barcodes from each read pair were removed, concatenated together, and stored in a separate file. Read pairs were assembled using fastq-join from the ea.-utils package, requiring at least 40 bases of overlap and allowing a maximum of 10% mismatched bases. Read pairs that could not be assembled were discarded. The concatenated barcode sequences were prepended to the corresponding assembled reads, and the resulting sequences were converted from FASTQ to FASTA and QUAL files for QIIME analysis. Barcodes, forward primer, spacer, and reverse primer sequences were removed during de-multiplexing. Reads containing more than four mismatches to the known primer sequences or more than three mismatches to all barcode sequences were excluded from subsequent processing and analysis. Assembled reads were truncated at the beginning of the first 30 base window with a mean Phred quality score of less than 20 or at the first ambiguous base, whichever came first. Resulting sequences shorter than 300 bases or containing a homopolymer longer than six bases were discarded. Operational taxonomic units (OTU) were picked using the reference-based USEARCH (version 5.2) [59] pipeline in QIIME, using the May 2013 release of the GreenGenes 99% OTU database as a closed reference [60, 61]. An indexed word length of 128 and otherwise default parameters were used with USEARCH. Chimera detection was performed de novo with UCHIME, using default parameters [59]. OTU clusters with less than four sequences were removed, and representative sequences used to make taxonomic assignments for each cluster were selected on the basis of abundance. The RDP Naïve Bayesian Classifier was used for taxonomic classification with the GreenGenes reference database, using a minimum confidence threshold of .85 and otherwise default parameters [62]. Phylogenetic investigation of communities by reconstruction of unobserved states (PICRUSt) [63] was used with the provided pre-processed KEGG Orthologs database to infer the putative functional capacities of these communities.

16S rRNA microbiota data pre-processing

To ensure the quality of statistical analysis, microbiome samples with < 12,000 total reads were excluded from the subsequent data analyses. Microbiota abundance data were summarized at six different levels (level 2: PHYLUM–level 7: SPECIES). For characterization of the microbiota phases and within phase abundance analyses, raw relative abundance values were used. For beta diversity calculations, normalization by rarefaction at a depth of 12,000 reads was performed. For longitudinal abundance analyses, at each taxonomic level we excluded OTU units (taxa) with equal or more than 98% of exactly zero reads among the 705 samples. In total, 140 genera and 198 species are used for these statistical analyses. The abundance data were log2 transformed (log2(x + 1)) following normalization by cumulative sum scaling [64].

Description of decision tree logic to define microbiota phases

Drawing on the microbial dysbiosis index described by Gevers et al. [65], the first step in the decision tree is to compute and evaluate the log of (total abundance of the classes increased in prematurity (Bacilli + Gamaproteobakterije)) over (total abundance of the class decreased in prematurity (Clostridia)). If this value is less than or equal to two, the gut microbiota is defined as being in phase 3. If the result of the first step in the tree is greater than two, a second step is taken where we compute and evaluate the log of (total abundance of the class increased in extreme prematurity (Bacilli)) over (total abundance of the class decreased in extreme prematurity (Gamaproteobakterije)). If the resulting value is less than or equal to two, the gut microbiota is defined as being in phase two otherwise, it is defined as being in phase one (P1). In the event that the ratio is non-computable because Clostridia is entirely absent and the P1|P2 branch is taken, or the P1|P2 branch is taken and Gamaproteobakterije is absent, the microbiota is defined as being in P1 or the P1|P2 branch is taken and Bacilli is absent, the microbiota is defined as being in P2. If two of the three classes are absent, the microbiota is defined as being in the phase characterized by the class that is present. No samples were entirely devoid of all three classes, but such a case could not be resolved within this framework. Dirichlet multinomial mixture (DMM) modeling for comparative purposes was performed using the Dirichlet multinomial R package, which is based on Holmes et al. [66]. Class-level composition was used, and per sample normalization was performed by converting relative abundances to counts summing to 12,000 (the minimum read threshold for inclusion in analysis). The dmn function was used with default parameters and an arbitrary seed value of 11 count data was fit to one through ten Dirichlet components, and model fit was estimated using the Laplace metric.

Functional capacity of microbiota phases

The functional capacity of the microbiota present in each sample was inferred using PICRUSt (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States) [63], which reconstructs the functional composition of a microbial community sample using 16S rRNA phylogeny and a database of annotated reference genomes. For each functional pathway from the Kyoto Encyclopedia of Genes and Genomes (KEGG) that was putatively identified, comparisons were made between the phases using LEfSe, which identifies features that are statistically differentially abundant among biological classes (in this case phases) and then performs comparative tests between pairs of biological classes to identify where these features are significantly enriched or diminished.

Comparing taxonomic composition, functional capacity, and week-to-week dissimilarity between phases

Analysis of variance of taxa abundance at all taxonomic levels across the three phases of the microbiota was conducted using a Kruskal-Wallis test, and the results are summarized in Additional file 4: Table S3. Differential abundance of taxa between each pair of two phases was assessed at each taxonomic level using the metagenomicsSeq zero-inflated Gaussian test [64], and the results are summarized in Additional file 5: Tables S4A–C. Testing for differential functional capacity between the phases was performed using LEfSe [67] with per-sample normalization to 1 M total counts, minimum effect size of 2.0, alpha of 0.1, an all-against-all strategy, and otherwise default parameters. The results are summarized in Additional file 6: Table S5. An exploratory test of the equality of the median of the week-to-week differences of samples within individual subjects between the cases where the phase remains the same and the cases where the phase changes was performed using the Wilcoxon rank-sum test. The str value reported for this test is approximate due to the paired nature of beta-diversity and the presence of repeated measures from the same subjects.

Transition from meconium to solid stool

The point of stool transition from meconium to normal as described in the text was determined from nurses’ records subjectively characterizing diaper contents when they were changed. These records were available as free text and each entry was time stamped, with one entry for every time a diaper was changed. Stool transition was defined as the first such record without the word meconium that was followed by no more than two records containing the word meconium. To assess the associations between day of life (DOL) of stool transition and day of life of initial transition out of phase one, a simple linear regression model was used with DOL of transition out of phase 1, gestational age at birth as covariates, and DOL of stool transition as the outcome. A similar regression model was used to assess the association between growth and time to reach phase 3. The DOL of the first phase 3 sample observed for each subject and their gestational age at birth were used as covariates, and the total change in weight Z-score from birth to discharge was used as the outcome variable. This model included only the 81 subjects who reached phase three prior to discharge.

Determination of early and late time periods

We applied functional principal component analysis to the microbiota abundance data [21]. The estimated temporal abundance function of taxon v i predmet I, ( >_(t) ) , was represented by a linear combination of eigen-functions as follows:

Here, ( >_v(t) ) is the estimated mean curve for the vth taxon, ξ k, v(t) je kth eigen-function for this taxon, K v is the number of top eigen-functions needed to explain ≥ 99% of total functional variation, and c ik, v are the linear coefficients. On average, it takes 2.93 functional principal components to explain ≥ 99% of total variation at the species level. We calculated the total functional variance based on the fitted microbiota abundance at the species level. More specifically, we computed the pointwise variance function for each species from the smoothed temporal curves of abundance at the species level, then took the summation over all species used in this study

Here, ( >_(t) ) represents the sample mean abundance function calculated from all subjects. ( overline(t) ) represents the overall temporal variance at the species level. The maximum of ( overline(t) ) occurred at PMA = 34 weeks (rounded to integers), which is illustrated in Additional file 2: Figure S5. Based on this cutoff, we define the EARLY period of PMA to be (0,34) and the LATE period to be [34,∞). The EARLY interval has 362 data points the LATE interval has 343 data points.

Association between clinical variables and microbiota abundance in each phase

Within each phase independently, association testing between all taxa and clinical and nutritional factors of interest was performed by regressing the relative abundance of each taxon on these covariates: gestational age at birth, post menstrual age, total calories per kilogram in the past week, ratio of lipids in the past week, ratio of proteins in the past week, ratio of carbohydrates in the past week, proportion of total calories received enterally in the past week, whether antibiotics were received in the past week, whether diuretics were received in the past week, whether corticosteroids were received in the past week, whether motility agents were received in the past week, whether proton pump inhibitors were received in the past week, and whether H2 receptor antagonists were received in the past week. This was done using the MaAsLin algorithm [68] with subject as a random variable, without model selection, and with otherwise default parameters. The results are summarized in Additional file 7: Table S6.

Association between nutrition/medication and growth

We performed linear mixed-effect regression analysis similar to the above model on both early and late periods (Model A) and three phases (Model B) to test the association between the nutrition/medication factors (as covariates) and weight Z-score as a proxy for growth (as the response variables). We included gaBirth (gestational age at birth) and PMA in the model to control for their possible confounding effects. More specifically, the following two linear mixed-effects regressions were performed.

Here, NutriMed(i,k) (t j) je kth clinical covariate for the ith subject measured at the jth time point. β k is the corresponding linear coefficient (fixed effect) α i is a random-effect term that quantifies the within-subject dependence and ϵ ij je i.i.d. measurement error. In summary, model A associates weight Z-score to the time periods (EARLY versus LATE), nutrition and medication variables, and their interactions. Model B is much like model A except that it uses microbiota phases to quantify the developmental stages of microbial community instead. For model A, LATE is considered as the baseline phase (coded as 0) and EARLY is coded as 1. For model B, phase 3 is considered as the baseline phase (coded as 0) phases 1 and 2 are coded as 1 in two separate binary variables. The interactions included in both models are defined as the products of the nutrition/medication variables and period/phase-related covariates. The significance of associations is determined by regression t test with Satterthwaite’s approximation. Due to the use of large number of covariates in these models, stepwise model selection based on the Akaike information criterion (AIC) was used to reduce model complexity. The results of model B for weight Z-score are summarized in Table 2 of the main text. As an example, the linear associations of P2 and percent lipids * P2 with the weight z-score are both significant (beta = − 0.7766 for P2 and 5.658 for lipids * P2) meaning that while P2 is correlated with a smaller weight z-score as compared with the baseline (P3), a higher percent of lipid intake for P2 subjects increases the weight Z-scores for subjects in P2. Analyses were performed in R 3.2.0 (R Foundation for Statistical Computing, Vienna, Austria).

Predicting microbiome phases

We performed a mixed-effects logistic regression analyses to study the associations between a host of nutrition- and medication-related covariates and the three microbiota phases on the early and late intervals. We considered P3 as the baseline phase and represented P1 and P2 by two separate binary outcome variables. Gestational age at birth and PMA were included to control for their potential confounding effects. A likelihood ratio test was used to determine the statistical significance of associations. The results are summarized in Tables 3A and B.


Pogledajte video: Ljetna prehrana (Februar 2023).