Informacije

Doživljavaju li T-stanice infiltrirane tumorom dugotrajne posljedice zbog hipoksije nakon što se vrate u normoksiju?

Doživljavaju li T-stanice infiltrirane tumorom dugotrajne posljedice zbog hipoksije nakon što se vrate u normoksiju?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Terapija usvajanjem ćelijskih transfera (ACT) pomoću limfocita koji infiltriraju tumor (TIL) je vrhunac imuno-onkoloških tretmana koji uključuju metastatski melanom i druge indikacije (1). Ideja je da su u nekom trenutku tokom rasta tumora, neke T ćelije pokušale da pokrenu imunološki odgovor, ekstravazirale su i ušle u tumor, ali su postale preplavljene i iscrpljene. Sama terapija uključuje vađenje ovih stanica iz nekog izrezanog tumora, poništavanje njihovog stanja, a budući da su već specifične za neo-antigen od pokušaja napada na taj rak: proširite ih, vratite ih pacijentu, pustite ih da pogode tumor mnogo teže nego ranije.

Ne samo da trebate preokrenuti iscrpljenost u TIL-u, već morate imati i pravu populaciju T ćelija da biste dobili najbolji odgovor. Faktori koji su u pitanju su izvan ovog pitanja, pa ću prijeći na stvar.

U okruženju tumora, T ćelije se iscrpljuju i mijenja se njihov profil ekspresije (2). To ih čini sklonijim apoptozi i gube efektorske funkcije poput proizvodnje GranzymeB. Možete reći kako je to problematično. Moja sumnja je da u tumoru T ćelije mogu postati hipoksične, a ono što znamo je da na putu osjećanja kisika faktori inducirani hipoksijom imaju svoj učinak. Obično ih treba kontrolirati inhibiranjem proteina ako se proizvode pod normoksijom:

I tako na moje pitanje:

Nakon dužeg izlaganja hipoksija, postoje li regulatorne ili transkripcijske promjene koje nakon dužeg povratka normoksija render ili HIF1α ili HIF2α aktivna gdje bi obično bili potisnuti?

Bilo da mi samo treba svjež pogled ili podaci jednostavno ne postoje, očito ih nisam nužno pronašao. Htio bih znati postoji li regulatorni okvir sličan zaostaloj hipoksiji koji ostaje nakon što se O2 vrati u normalu i utječe na puteve poput mTORC1/2. Hvala ako unapred za bilo kakav uvid!


Kardiovaskularna adaptacija na hipoksiju i uloga perifernog otpora

Sistemski vaskularni tlak kod kralježnjaka regulira niz faktora: jedan ključni element kontrole je periferni otpor u tkivima kapilarnih naslaga. Mnogi aspekti veze između centralne kontrole vaskularnog protoka i perifernog otpora su nejasni. Važan primjer ovoga je odnos između hipoksičnog odgovora u pojedinim tkivima i učinka koji odgovor ima na sistemsku kardiovaskularnu adaptaciju na nedostatak kisika. Ovdje pokazujemo kako hipoksični odgovor putem transkripcijskih faktora HIF -a u jednom velikom vaskularnom krevetu, koji se nalazi ispod kože, utječe na kardiovaskularni odgovor na hipoksiju kod miševa. Pokazali smo da odgovor kože na hipoksiju utječe na širok raspon kardiovaskularnih parametara, uključujući broj otkucaja srca, arterijski pritisak i tjelesnu temperaturu. Ovi podaci predstavljaju prvu demonstraciju dinamičke uloge senzora kisika u perifernom tkivu koji direktno modificira kardiovaskularni odgovor na izazov hipoksije.


DEFINIRA TUMORSKA HIPOKSIJA

Normoksija i fizoksija

Unatoč mnogim studijama o tumorskoj hipoksiji, postoji znatna zabuna u upotrebi izraza "normoksija" i "hipoksija". Mjerenja oksigenacije u normalnim tkivima pokazuju da pokazuju različite normalne vrijednosti koje variraju među tkivima (Tablica 1). Međutim, "normoksija" se gotovo univerzalno koristi za opisivanje "normalnih" razina kisika u tikvicama za kulturu tkiva, tj. oko 20-21% kiseonika (160 mmHg). Iako to nije točno, jer ovisi o nadmorskoj visini i dodanom CO2, za većinu situacija, 20% je dobra aproksimacija. Uprkos široko rasprostranjenoj upotrebi „normoksije“, ovo je daleko od preciznog poređenja za oksigenaciju perifernog tkiva. Čak i u plućnim alveolama, nivo kiseonika je smanjen na oko 14,5% kiseonika (110 mmHg) prisustvom vodene pare i izdahnutog CO.2. 13 Dalje opada u arterijskoj krvi, a do trenutka kada dosegne periferna tkiva, srednji nivo kisika kreće se od 3,4% do 6,8% s prosjekom od oko 6,1% (Tablica 2). 13

Tabela 1. Približni nivoi kiseonika u normalnim tkivima i tumorima

aNe moguće je staviti tačne brojke na nivo tkiva. Navedene vrijednosti su vodič izveden iz nekoliko izvora (vidi također Tabelu 2).

bNormalni fiziološki odgovori na hipoksiju javljaju se iznad oko 15 mmHg (2% kisika). Normalno tkivo ne bi trebalo da padne ispod ove vrednosti jer homeostaza ima tendenciju da vrati nivo kiseonika u fizoksiju. Tačan nivo kiseonika za regulaciju gena za odgovor na hipoksiju nije poznat, može varirati između različitih tipova tkiva/ćelija jer normalna tkiva imaju različite srednje vrednosti kiseonika.

c Prisustvo patološke hipoksije ukazuje da se tkivo nije moglo vratiti u fizoksiju. U normalnim tkivima, postojanost niske količine kiseonika će uzrokovati nekrozu tkiva, što može imati značajne funkcionalne posljedice. To se može dogoditi i kod tumora. Budući da je tumor abnormalni rast, gubitak tkiva nekrozom nema poznati funkcionalni značaj. Međutim, tumorske ćelije otporne na hipoksiju na kraju će na kraju postati mirne, bit će odabira za malignije tumorske stanice otporne na hipoksiju.

Tabela 2. Sažetak prijavljenih vrijednosti parcijalnog pritiska kiseonika (pO2) u ljudskim tumorima i srodnim normalnim tkivima

n, broj pacijenata ND, nije utvrđeno.

Podaci uključeni u tabelu su prvenstveno sažetak iz meta-analize koju su sproveli Vaupel et al. 5 Broj uključenih studija za svaki tip tumora označen je brojem u koloni „tip tumora“. Ostali podaci su iz pojedinačnih studija, kako se navodi. Konačne "prosječne" vrijednosti za oksigenaciju tumora i normalnog tkiva su samo indikativne, samo su date za ilustraciju razlike između dvije vrijednosti. Raspon je značajan i odražava različito tkivno podrijetlo tumora unatoč tome, postoji vrlo ograničeno preklapanje s podacima o normalnom tkivu. (Prosjeci su izračunati prilagođavajući se broju vrijednosti u svakoj kohorti.)

aFld -smanjenje tumora vs normalno tkivo je zasnovano na svim podacima prikazanim u tabeli (osim prostate vidi dalje napomene).

b Smanjenje nabora izračunato na istovremenim mjerenjima u psoas mišiću.

cPodaci iz pilot studije koja je uključivala vrijednosti iz "normalne" prostate dva pacijenta s rakom mokraćne bešike.

Ovo jasno naglašava anomaliju pojma “normoksija”. Budući da su normalna periferna tkiva izložena razinama kisika oko 75% niže od udahnutog zraka, predlaže se da je 5% kisika (38 mmHg) preciznija aproksimacija oksigenacije tkiva i da se to treba prepoznati kao "fizoksija" protiv koje drugi eksperimentalni uslove treba uporediti. Istraživači ne prihvaćaju takvu netočnu vrijednost za druge parametre, poput pH, glukoze itd., No, iznenađujuće, zanemaruju važnost kontrole kisika, za koji se već dugi niz godina zna da je otrovan. 34 Treba napomenuti da izjednačavanje medija za kulturu s nivoom kisika u određenoj mješavini plinova može potrajati i do 3 h 35, što se može izbjeći ako je plinska smjesa u izravnom kontaktu s ćelijskim jednoslojnim slojem, što se može postići ako su stanice uzgaja se u bocama za kulturu koje propuštaju kisik (www.coylab.com). Budući da je % kisika fiziološki značajniji od mmHg, predlaže se da je % kisika bolja jedinica za izvještavanje o razinama kisika jer adekvatnije ilustruje relativno niske, ali jasno normalne razine kisika u mnogim tkivima, također bolje naglašava posebno niske razine kiseonika koji se nalazi u tumorima. (Napomena: SI jedinica za pritisak gasa je kpascal, slučajno 100% kiseonika je ekvivalentno 101,3 kpascal, tako da su ove jedinice numerički skoro ekvivalentne.)

Donja granica fizoksije je oko 3% kisika (23 mmHg) (Tabela 1). Homeostaza održava fiziološke parametre u strogim granicama, pri čemu pojedinačna tkiva imaju poželjne srednje vrijednosti kisika (Tablica 2, vidi također Carreau et al. 13). Ova varijacija sugerira da ćelije različitog porijekla imaju različitu osjetljivost na kisik, a poznato je i da normalna tkiva imaju raspon tolerancije na smanjenje kisika. Tkivo mozga je posebno osjetljivo i može preživjeti samo oko 3 minute bez odgovarajuće oksigenacije, dok su druga tkiva tolerantnija, npr. bubrezi i jetra (15–20 min), skeletni mišići (60–90 min), glatki mišići krvnih sudova (24–72 h) i kosa i nokti (nekoliko dana). 36

Fiziološka hipoksija

“Fiziološka hipoksija” se tada može definirati kao nivo kisika na kojem tkiva reagiraju da održe željeni nivo kisika. To može biti fiziološkim putem, npr. vazodilatacija, povećanje protoka krvi i/ili povećana regulacija gena za odgovor na hipoksiju. 12 Budući da se fizoksija razlikuje za pojedina tkiva, vjerojatno će imati različite hipoksične okidačke točke ispod kojih se to događa. U normalnim tkivima, ovo će vjerovatno biti prolazno, ali dovoljno da se tkivo vrati na željeni nivo kiseonika. Međutim, budući da se normalno tkivo obično održava na 3–7% kisika, fiziološka hipoksija će vjerojatno biti u rasponu 2–6% kisika. Ovo sugerira da elementi odgovora na hipoksiju mogu dobro regulirati različite razine kisika u različitim tkivima. Trenutno je teško zamisliti kako se može izmjeriti "fiziološka hipoksija", jer bi homeostaza trebala djelovati na njezinu gotovo promjenu, pa bi svaka manifestacija bila prolazna. To će se održati brojnim promjenama, uključujući povećanje perfuzije i privremenu stabilizaciju faktora induciranog hipoksijom (HIF), dok se vrši prilagođavanje. 37 Kada se mjerila ekspresija HIF1α i HIF1β u kultiviranim HeLa stanicama od 0% do 20% kisika, maksimalni odgovor je nađen pri 0,5% kisika s pola maksimalne ekspresije pri 1,5-2% ekspresije kisika bio je značajno niži iznad 4% kisika, 38 potvrđujući da je HIF1 aktivan u potrebnom rasponu za kontrolu fizioloških odgovora na nedostatak kisika (o čemu će biti riječi u nastavku).

Patološka hipoksija

Utvrdivši približan raspon "fiziološke hipoksije", ovo pomaže u ocrtavanju nivoa kisika koji se nalazi u patologiji. Zaista se postavlja pitanje, zašto u patološkim tkivima homeostatski mehanizmi ne reagiraju učinkovito kako bi poništili pad razine kisika? Kod ishemijske bolesti koja može biti kronična (npr. kod dijabetesa, smanjene funkcije pluća itd.) ili akutnog (npr. moždani udar, okluzija koronarne arterije itd.), ponovno uspostavljanje homeostaze možda neće biti moguće zbog gubitka/okluzije/smanjenog protoka krvnih sudova koji hrane dotično tkivo. Međutim, kod tumora često postoji pojačana angiogeneza, ali su razine kisika (čak i kod neliječenih tumora) značajno niže, u rasponu od 0,3% do 4,2% kisika (2-32 mmHg), pri čemu gotovo svi padaju ispod 2% (Tabela 2). Općenito je poznato da je vaskularna tumora kaotična i da se sastoji od propusnih žila sa slijepim krajevima, šantovima i tendencijom kolapsa. 39 Jasno je da vaskulatura ne uspijeva održavati nivo kisika koji je znatno ispod susjednih normalnih tkiva (Tablica 2), unatoč dokazima u mnogim situacijama da je HIF1 reguliran prema gore. 40

Stoga je jasno da su tumori dobro prilagođeni za rast i širenje u ovom tumorskom mikro-okruženju koje je trajno osiromašeno kisikom (TME). U definiranju “patološke hipoksije” nema apsoluta, međutim, realnost je da svi tumori imaju tendenciju da imaju srednji nivo tumorskog kisika

Kod tumora se čini da su homeostatski procesi poremećeni iz dva glavna razloga. Prvo, vaskulatura je vrlo loše kvalitete i ne može adekvatno i pouzdano osigurati kisik rastućem tumoru. Zaista, ako bi pretpostavljene tumorske ćelije bile osjetljive na nizak nivo kisika, umrle bi jer je nivo kisika nedovoljan. To dovodi do drugog glavnog razloga: jasno je da tumorske stanice ne umiru, pokazujući da je njihov značajan dio značajno tolerantan na hipoksiju. Djelomično se to može pripisati njihovom prelasku na glikolizu za opskrbu većine svojih energetskih potreba, što je karakteristika tumora koju je prije mnogo godina identificirao Warburg. 41 Osim toga, izlaganje produženoj patološkoj hipoksiji će odabrati tumorske ćelije tolerantne na hipoksiju koje su otporne na stres i malignije (vidi dolje). Teško je biti precizan u vezi sa tačnom količinom kiseonika na kojoj se to dešava, međutim, to je skoro sigurno <1% kiseonika (7,5 mmHg) i može biti znatno niže. Važno je napomenuti koliko se tumorske ćelije dobro prilagođavaju značajno niskim nivoima kiseonika. U jednoj studiji, hipoksija je uzrokovala smrt tumorskih ćelija samo kada su nivoi kiseonika bili in vitro do 48 h ili duže od 0,1% kiseonika. 43 U novije vrijeme pokazali smo da je srednji nivo kisika u ksenotransplantatima prostate tretiranim bikalutamidom LNCaP ostao ispod 0,1% kisika više od 10 dana. 44 Općenito, preživljavanje u ovom ekstremnom stresu potaknut će selekciju na maligne fenotipe koji su podložni darvinističkom procesu odabira. 45

Varijabilnost oksigenacije tumora

Oksigenacija tumora obično se prijavljuje kao srednja vrijednost, međutim, postoji značajna heterogenost unutar pojedinih tumora. 5 Osim toga, mikroregionalna oksigenacija je nestabilna, a razina kisika varira unutar tumora ovisno o funkcionalnosti i blizini lokalnih krvnih žila. 46 Zaista, pokazano je u tumorima štakora da se neke varijacije u oksigenaciji mogu pripisati promjenama u protoku crvenih krvnih zrnaca. 47 “Bolje oksigenirane” tumorske ćelije oko funkcionalnih kapilara će dobiti nešto kisika, iako je rijetko onoliko koliko primaju normalne ćelije (Tabela 2). Međutim, dovoljno je omogućiti diobu stanica i rast tumora, što je gotovo sigurno potaknuto povećanom razinom glikolize spomenutom gore. 41 Zaista, to također može biti olakšano povezanim smanjenjem aktivnosti mitohondrija. 48 Kako se stanice dijele i udaljavaju od kapilara, one primaju manje kisika i što su distalnije stanice kronično hipoksične 49 na kraju, stanice umiru i tkivo postaje nekrotizirano. U histološkim presjecima, održive ćelije se često vide kao "žice" aktivno rastućih stanica oko perfuziranih krvnih žila do oko 150 µm, iako je ova udaljenost još jedna varijabla za koju se različito navodi da se kreće od 70 do 200 µm. 2,47,50,51 Varijabilnost je vjerojatno povezana s dva glavna faktora: (i) potreba za kisikom određene vrste tumorskih stanica i (ii) njena tolerancija na hipoksiju. Što su ćelije metabolički aktivnije, to će tumorske niti biti manje. Kad stanice postanu patološki hipoksične, udio stanica u ovoj frakciji ovisit će o njihovoj toleranciji na hipoksiju. Što su tolerantniji, duže će ostati mirni, ali i dalje održivi, ​​što će rezultirati proporcionalno hipoksičnim tumorom s većom hipoksičnom frakcijom. Nasuprot tome, tumorske ćelije osjetljive na hipoksiju će brže umrijeti, pa će hipoksična frakcija biti manja.

Osim toga, budući da su krvne žile neadekvatne i limfna drenaža gotovo da ne postoji, intersticijski tlak fluktuira, uzrokujući povremeni vaskularni kolaps. Ćelije oko srušene krvne žile postat će "akutno hipoksične" koliko dugo to može varirati, ali pokazalo se u tumorima životinja da se kreću od 20 minuta do nekoliko sati. 52,53 Jasno je da je ovo dinamična situacija i opet može biti mnogo duža/kraća od citiranih brojki jer se brojke odnose na vremena odabrana u objavljenim studijama (pregledano od strane Bayera i Vaupela 54). Ćelije u ovom odjeljku (ako ne umru) će vjerovatno i dalje biti u ciklusu, posebno ako je akutna hipoksija kratka. Oni će biti sposobni da se ponovo nasele tumor brže od "hronično hipoksičnih" ćelija u mirovanju. Međutim, oni će biti zaštićeni od RT (zbog nedostatka kisika) ili CCT (zbog nedostatka isporuke), ako su posude zatvorene tijekom razdoblja izloženosti liječenju. Postoje neki dokazi koji upućuju na to da je vjerojatnije da će akutne hipoksične stanice doprinijeti malignoj progresiji. 54–56

Stoga se zaista mogu očekivati ​​varijacije u očitanjima oksigenacije tumora, pojedinačna očitanja se razlikuju od tumora, iako na nivoima kisika koji su uglavnom u patološkom rasponu. 46 U kliničkim studijama srednji nivoi u različitim vrstama tumora iz različitih studija često su, iako ne uvijek, slični (Tablica 2). To daje sigurnost da su mjerenja stvarna i da medijane, iako zasnovane na značajnom rasponu pojedinačnih očitanja, pružaju pravi pokazatelj srednje oksigenacije u tumorskoj masi. Kod LNCaP ksenotransplantata, otkrili smo da je srednji nivo kiseonika u tumorima tretiranim nosačem značajno reproducibilan (o čemu se govori u nastavku). 44 Kod ljudi je pokazano da je srednji nivo kiseonika u normalnom tkivu dojke bio izuzetno konstantan bez obzira na nivo hemoglobina u krvi. To je bilo u suprotnosti s tumorima dojke, koji su pokazali i značajno niži nivo pO2 nego normalno tkivo i takođe pad, na ionako niskom nivou, jer se koncentracija hemoglobina smanjila. 57

Tumorska hipoksija i maligna progresija

Nije iznenađujuće što je sada jasno da hipoksija uzrokuje mnoštvo genetskih promjena koje su pretežno, ali ne isključivo, posredovane putem HIF1 i HIF2. 40 Kao što je gore rečeno, u normalnim stanicama ekspresija HIF1 uključena je u održavanje oksigenacije tkiva u normalnim granicama. Njegov odgovor je dizajniran da bude gotovo trenutačan budući da se aktivni transkripcijski faktor HIF1 sastoji od konstitutivno izraženog HIF1β i nestabilnog proteina HIF1α. Potonji se stalno proizvodi i razgrađuje, čime se njegov nivo u fizikalnim ćelijama održava značajno niskim. Čim nivo kisika padne, uklanjanje HIF1α se inhibira dopuštajući stvaranje kompleksa HIF1, što odmah izaziva mnoštvo promjena koje u normalnim stanicama izazivaju povratak u fizoksična stanja. 37,58 Međutim, u tumorima ekspresija HIF1 često traje bez obzira na razinu kisika, to sugerira da postoji adaptivni odgovor u tumorskim stanicama koji ih čini znatno manje ovisnima o kisiku. U nekim tumorskim stanicama to može biti konstitutivna promjena u ekspresiji HIF -a, a u drugima je uzrokovana genetskom promjenom u jednom ili više složenih nizova proteina koji pomno kontroliraju ekspresiju HIF -a u normalnim stanicama. 37,58 Ovo utvrđuje vrlo različit fenotip od normalnih (fizoksičnih) ćelija. Pogodno je da prilagođene tumorske stanice stječu znatno smanjenu potrebu za kisikom, što dovodi do značajno poboljšane sposobnosti preživljavanja u hipoksičnim stanjima koja je povezana s njihovom sposobnošću da koriste glikolizu kako bi zadovoljile svoje energetske potrebe. 41,48

Prelazak na fenotip reguliran HIF1 promovira selekciju za stotine gena, od kojih su mnogi povezani sa malignijim fenotipom. Na primjer, postoji prelazak na angiogeniji fenotip s pojačanom regulacijom gena, kao što je vaskularni endotelni faktor rasta (VEGF) i interleukin 8 (IL8), dok su inhibitori angiogeneze sniženi, npr. angiostatin i endostatin. Drugi geni/putevi uključeni u ovaj hipoksični odgovor uključuju nuklearni faktor κ B, aktivatorski protein-1, cilj rapamicin kinaze kod sisara i nesavijeni proteinski odgovor. 59–61 Iako se ti geni/putevi aktiviraju nezavisno, što ukazuje na redundanciju u putevima osjetljivim na kisik, postoje i dokazi da mogu odgovoriti na hipoksiju na integriran način. 62

Rane studije su pokazale da je hipoksija odabrana za ćelije s defektima u apoptozi. 6 Daljnji izvještaji su potvrdili da hipoksija može nametnuti selekcijski pritisak koji omogućava ekspanziju klonalne varijante in vitro 43,63,64 i in vivo. 55 Studije u našoj laboratoriji su pokazale da su miševi koji su nosili LNCaP ksenotransplantate izloženi hipoksiji izazvanoj bikalutamidom imali povećane metastaze u plućima što je povezano s povećanjem Bcl2 i smanjenjem Bax. 44 Pojačavanje gena je takođe prijavljeno u izloženim tumorskim ćelijama glodara ex vivo ili in vivo za hipoksiju je to bilo povezano s povećanjem metastaza. 65,66 I u kulturi tkiva i u životinjskim modelima, akutna hipoksija/reoksigenacija povezana je s indukcijom lomova DNK lanca i jasno je da će, ako se ti prekidi ne poprave, rezultirati daljnjim mutacijama. Zaista, postoje značajni dokazi da su procesi popravke DNK u tumorima također modificirani hipoksijom i da je to povezano s povećanjem genetske nestabilnosti. 67

Druge studije su pokazale da hipoksija može povećati malignu progresiju/metastaze pojačavanjem gena povezanih s metastazama, poput osteopontina, lizil oksidaze, CXCR4, IL8 i VEGF i mnogih drugih, prvenstveno stabilizacijom HIF1. 68–70 Ovo također može biti povezano s povećanjem MDM2, koji je inhibitor p53, i in vivo to dovodi do otpornosti na apoptozu i povećanog stvaranja metastaza. 71,72 Nedavno je pokazano da se zračenjem mogu odabrati i tumorske stanice koje prekomjerno izražavaju HIF1. Nakon zračenja, in vivo Stanice koje prekomjerno eksprimiraju HIF1 premještaju se prema krvnim žilama tumora, inhibicija HIF1 blokira ovaj učinak, a također smanjuje ponovno rast tumora. 73

Nemoguće je raspravljati o svim genetskim promjenama prijavljenim kao odgovor na hipoksiju (za detaljnije preglede vidjeti 59,74–76). Međutim, postoji jedno pitanje koje treba komentirati. Često se mjere genetske promjene uzrokovane hipoksijom in vitro i u poređenju sa "normoksijom". To se najčešće opisuje ili pretpostavlja ako nije definirano, kao zrak koji sadrži 5% CO2 (tj. otprilike 20% O2) iznenađujuće, rijetko se može naći komentar o valjanosti ove pretpostavke. Međutim, kao što je gore objašnjeno, bilo bi relevantnije za normalno tkivo da se kontrolne ćelije održavaju u fizoksiji, tj. 5% O2i u usporedbi s fiziološkom hipoksijom (1–3%) i patološkom hipoksijom (0,5–0,1%). (Ove brojke su date kao rasponi, jer će nivo kiseonika koji je relevantan za određeno ispitivanje zavisiti od porijekla tumora i normalnog tkiva koje vas zanima - za relevantne vrijednosti pogledajte Tablicu 2.) Međutim, nivoi kisika se rijetko uzimaju u obzir u genetskim podacima studije in vitro, iako je vjerojatno da će biti kritično za jasno definiranje i usporedbu onoga što se događa u cijelim tkivima ili tumorima.

Nedostatak korelacije između in vitro stanice i solidni tumori potvrđeno je u nedavnoj studiji koja je identificirala stotine veznih mjesta za androgene receptore (ARBS) u biopsijama tumora prostate kod ljudi. Većina ovih ARBS-a nije identificirana u LNCaP stanicama tumora prostate koje su uzgojene in vitro međutim, mnogi su pronađeni u istim ćelijama koje se uzgajaju kao ksenografti u miševa lišenih androgena (kastriranih). Skup ljudskih gena identifikovan je iz ljudskih biopsija koje su nadmašile veći potpis izveden iz kultivisanih ćelija, takođe je identifikovan u kseno transplantiranim tumorima LNCaP, ali ne i u uzgojenim ćelijama LNCaP in vitro, što ukazuje da TME ima veliki uticaj u kontroli signalizacije androgenih receptora kod tumora prostate. 77 Ovo opet naglašava da treba biti oprezan pri usporedbi podataka iz in vitro studije, posebno kada se ćelije uzgajaju u "normoksiji".

Homeostaza kisika u tumorskom mikrookolju i odgovor na liječenje

Zašto homeostatski mehanizmi ne reagiraju na obnavljanje homeostaze kisika u tumorima? Jasno je da je angiogeneza stimulirana, ali formirana vaskulatura je nedovoljna za održavanje kisika na fizikalnim razinama uprkos ekstenzivnom formiranju kapilara kod mnogih tumora. Ako se, kao odgovor na produženi hipoksični stres, tumorske ćelije prilagode/mutiraju kako bi proizvele još više pojačane razine proangiogenih faktora, tada će tumoru pružiti prednost u preživljavanju. Kada proangiogeni faktori dosegnu kritične razine, vaskulatura će se poboljšati (moguće normalizirati) 78 i tumor će ponovno narasti. Nažalost, kada se to dogodi, vjerovatno će se ponovo naseliti proangiogenim ćelijama koje su tolerantne na hipoksiju, malignijim tumorskim ćelijama.

Upravo se to dogodilo kada su miševi koji nose tumore LNCaP svakodnevno bili liječeni bikalutamidom, lijekom koji se široko koristi u lokalno uznapredovalom raku prostate. Netretirani ksenografti LNCaP bili su slabo oksigenirani (0,8% kisika 6 mmHg), što je bilo slično razinama kisika utvrđenim u kliničkim studijama (0,9% kisika, 7 mmHg Tablica 2). Kada su miševi svakodnevno bili tretirani bikalutamidom 28 dana, nivo kisika je naglo padao tokom 1-3 dana na ≤0,1% kisika, ova duboka hipoksija održavala se više od 10 dana. Međutim, u narednih 10 dana nivo kiseonika se povećao, vraćajući se na nivo skoro prije tretmana. Kada su tumori porasli in vivo u prozorskim komorama primijećen je značajan gubitak krvnih žila u prvih 14 dana liječenja bikalutamidom nakon čega je uslijedio angiogeni udar. Ovaj karakterističan dvofazni odgovor pripisan je malom padu, a zatim i većem povećanju proangiogenih faktora, uključujući VEGF i najizraženije IL8. Jasno je da ćelije tumora mogu preživjeti izloženost dubokoj hipoksičnoj uvredi i, unatoč blokadi androgena, inhibicija rasta na kraju je poništena proizvodnjom dovoljnih proangiogenih faktora koji stimuliraju neovaskularizaciju. Tumorske ćelije očito su mogle promijeniti svoju ograničenu opskrbu energijom za sintetiziranje ovih kritičnih faktora. Nakon 28 dana liječenja, izrezane tumorske stanice bile su invazivnije i otpornije na docetaksel od tumorskih stanica izrezanih iz miša tretiranog nosačem. Osim toga, miševi liječeni bikalutamidom imali su značajno povećanje metastatskog širenja u pluća, iako se to moglo uspješno blokirati tretmanom 7. dana s jednom dozom banoksantrona (AQ4N), prolijeka koji specifično cilja hipoksične ćelije. 44

Početni antivaskularni efekat anti-androgen bikalutamida nije široko priznat, iako su prethodne studije, koje su uglavnom koristile modele kastracije, pružile mnogo dokaza da će se to verovatno dogoditi (obrađeno u 44). Naše studije su pokazale da su tumorske stanice prostate vrlo tolerantne na hipoksiju. Kod drugih tipova tumora, ovo se može donekle razlikovati, međutim, treba napomenuti da tumorske stanice gušterače mogu biti posebno tolerantne na hipoksiju jer preživljavaju razine kisika ≥19 puta niže od onih u normalnom tkivu gušterače (Tablica 2). 23 Kada su ortotopijski ustanovljeni ksenografti dobijeni od pacijenata kod golih miševa, opseg hipoksije, mjeren pomoću hipoksičnog markera EF5, predviđao je agresivan rast i spontane metastaze. 79 Ljudski tumori gušterače posebno su otporni na liječenje, što je karakteristika koja se pripisuje njihovoj opsežnoj stromi. 80 Primamljivo je nagađati da otpornost na tretman može biti rezultat selekcije ćelija koje imaju sposobnost da prežive nivoe kiseonika mnogo niže od onih koje se nalaze u normalnom pankreasu i koje, posljedično, imaju posebno maligni fenotip.

Ako se izloženost lijekovima koji uzrokuju hipoksiju može odabrati za ćelije tumora tolerantne na hipoksiju/malignije, moguće je da bilo koji tretman koji uzrokuje povećanu i produženu hipoksiju može učiniti istu stvar. Ovo može biti glavni razlog zašto lijekovi za vaskularno ciljanje, koji se koriste kao pojedinačni agensi, nisu tako uspješni kao što se prvotno očekivalo. Zaista, uočena je značajna redundantnost angiogenih puteva, a revaskularizacija je također pronađena nakon početnih ranih antivaskularnih odgovora (pregled vidi 81). Većina tretmana protiv raka ili (i) direktno cilja krvne sudove ili (ii) cilja tumorske ćelije koje podržavaju funkcionisanje, ma koliko neadekvatno, tumorske vaskulature. Stoga je moguće da mnogi tretmani uzrokuju rane (često neprepoznate) antivaskularne učinke i povezano povećanje hipoksije. Pošto je nivo kiseonika u većini tumora već u patološkom opsegu, to može dovesti do kritičnog hipoksičnog uvreda.

To smo pokazali u tumorima prostate PC3 citotoksičnim lijekom docetakselom, koji je izazvao rani antiangiogeni učinak koji je dodatno pojačan deksametazonom. Ovo može objasniti zašto postoji kratkoročna (iako ne i dugoročna) efikasnost ove kombinacije kod pacijenata sa metastatskim karcinomom prostate. 82 Kao što je gore razmotreno, antiandrogen bikalutamid ima sličan početni i duboki efekat na vaskulaturu tumora, efekat koji smo takođe pronašli kod drugih mehanički različitih antitumorskih lekova (naši neobjavljeni podaci). Međutim, tumori se mogu prilagoditi ovom hipoksičnom inzultu i oporavljaju se s više proangiogenim i potencijalno malignim fenotipom. 44,83,84 Ovaj se problem može barem djelomično prevladati kombinacijom s drugim CCT -om. Prolijekovi aktivirani hipoksijom (HAP) (o kojima se govori u nastavku) nude dodatni pristup, budući da specifično ciljaju hipoksične ćelije. Jasno je da je potrebno bolje razumijevanje longitudinalnih promjena u oksigenaciji tumora izazvanih trenutnim terapijama, kako bi se efikasnije odredile kombinacije lijekova, uključujući HAP.


1. UVOD

T ćelije i posebno citotoksični CD8 + T limfociti (CTL) odavno su prepoznati kao važni u ograničavanju razvoja imunogenih tumora. 1 Prisutnost CTL -a unutar mnogih tumora stoga je pozitivan prognostički faktor. 2 Nasuprot tome, oslabljen antitumoralni imunološki odgovor obilježje je rastućih tumora. 3 Koncept imunonadzora protiv karcinoma vođenog T ćelijama doveo je do razvoja imunoterapije zasnovane ili na oživljavanju funkcije T ćelija in situ, uglavnom preko antitela koja ciljaju receptore imunološke kontrolne tačke, ili na prenosu genetski modifikovanih autolognih T ćelija sa poboljšanim antitumorsko djelovanje, uglavnom T-ćelije koje eksprimiraju himerne antigene (CAR). 4 Obje strategije osigurale su dosad neviđen nivo dugotrajne antitumorske aktivnosti u pacijenata s nekoliko metastatskih karcinoma. Međutim, većina pacijenata s uznapredovalim karcinomom još uvijek ne doživljava trajnu kliničku korist od imunoterapije, naglašavajući prisustvo barijera koje treba identificirati kako bi se osmislile strategije koje će ih prevladati. Neefikasna migracija T ćelija i, posebno, prodiranje u tumorsku masu može predstavljati važnu prepreku imunoterapije zasnovanoj na T ćelijama. Kao potpora ovoj ideji, različite kliničke studije pokazale su da su tumori obogaćeni T stanicama podložniji kontroli pomoću programirane blokade ćelijske smrti-1 (PD-1). In contrast, tumors with so-called “immune deserts” and immune excluded profiles, in which T cell are present within tumors but not in contact with malignant cells, are refractory to PD-1 blockade. 5 Migration might represent an even greater challenge for CAR T cell therapy, because the in vitro expanded T cells that are infused into the blood circulation need to home to the site of tumor development and then migrate toward the tumor mass.

There is currently a wide gap in our knowledge of the homing and migratory properties of CAR T cells, as well as to the location of these therapeutic cells over prolonged periods. The objective of this review is therefore to address key open questions, such as: what are the capacities of infused therapeutic T cells to home to target organs? How does the tumor microenvironment influence the motility behavior of engineered T cells? What are the strategies, which have been implemented to restore a defective CAR T cell migration? How should homing and motility properties of adoptively transferred T cells be monitored in preclinical models? By highlighting these points, we hope to stimulate a research focus at the interface between basic T cell biology and therapeutic development that will ultimately open new opportunities to improve antitumoral T cell based strategies.


Hypoxia Diminishes Electron Transport

Multiple studies throughout the 1970s and 1980s examined the oxygen dependence of the ETC (108, 109). These studies observed that exposure of cells to acute hypoxia (minutes to seconds) did not attenuate the flux of electrons through the ETC nor increase NADH levels in mitochondria. However, in the mid-1990s we reported that isolated mitochondria decreased coupled respiration and that isolated COX decreased its maximal velocity (Vmax) when exposed to chronic hypoxia (2 h) (30, 32). Thus there is an intrinsic oxygen dependence of COX during prolonged hypoxia. Another important regulator of COX activity is nitric oxide (NO) (36). Low concentrations (nM range) of NO reversibly inhibit isolated COX by competing with oxygen (15, 35, 80). Under aerobic conditions, oxygen levels are high enough to prevent NO from inhibiting COX activity (36). However, as oxygen levels fall, the low levels of NO are sufficient to inhibit COX activity. Low levels of NO under normoxia do not injure cells. However, the same low levels of NO are sufficient to inhibit respiration and initiate cell death under hypoxia (1.5% O2) (76). In the absence of NO, hypoxia alone does not have any deleterious effects on cells. It is likely that COX activity is compromised in inflammatory conditions where NO levels are high with concomitant tissue hypoxia. Furthermore, the NO-generating enzyme inducible NO synthase (iNOS) is a target of HIF-1 (65, 85). We propose that hypoxia diminishes COX activity by decreasing the Vmax of COX activity and by increasing NO levels to inhibit COX activity. Although this mechanism diminishes COX activity during hypoxia, the activity cannot be diminished to the point where respiration fails to meet the basal metabolic demands of cells. Therefore, cells ensure optimal COX activity during hypoxia by activating HIF-1 to induce subunit switch from COX4–1 subunit to COX4–2 (44). COX has 13 subunits, of which the three catalytic subunits COX I-III are encoded by mitochondrial DNA. The remaining regulatory 10 subunits including COX4 subunits are encoded by nuclear DNA. HIF-1 induces both the expression of the COX4–2 subunit and the mitochondrial protease LON, which targets COX4–1 subunit degradation to complete the switching of the COX4 subunits during hypoxia. Recently, another mechanism to downregulate the ETC is the finding that micro-RNA 210 (mir-210) blocks the expression of the iron-sulfur cluster assembly proteins ISCU1/2, which are required for the functions of complex I, COX subunit 10, aconitase, and subunit D of succinate dehydrogenase (28, 33, 42, 91). Using a miRNA microarray, Kulshreshta et al. (74) first discovered that miR-210 is regulated by hypoxia, and recently it was proposed to be the major micro-RNA upregulated during hypoxia. HIF-1, but not HIF-2, is responsible for the induction of mir-210 during hypoxia (57). The ectopic expression of mir-210 is sufficient to decrease mitochondrial respiration and upregulate glycolysis (33). Thus there are multiple mechanisms by which HIF-1 can coordinately diminish electron flux through the ETC (Fig. 3).

Slika 3.Hypoxia diminishes electron flux through the electron transport chain. Hypoxia diminishes respiratory activity by activating HIF-1, which increases micro-RNA 210 (miR-210), inducible nitric oxide synthase (iNOS), and switching of cytochrome c oxidase (COX)4–1 subunit to COX4–2. Hypoxia can also directly decrease complex IV (COX) activity.


3 RESULTS

3.1 Patient demographics

Table 1 summarizes the basic characteristics of the 70 patients (NACRT and US groups). In the NACRT group, the median age of the patients was 66 years, and 24 of them (60%) were male. NACRT was performed in three patients with R-PDAC, 35 patients with BR-PDAC, and two patients with LA-PDAC. A pancreatoduodenectomy was performed in 31 patients (79%). The NACRT group had a higher proportion of pretreatment diagnosis for BR- or LA-PDAC (93% vs 53%, P < .01) and a lower percentage of lymph node metastasis (40% vs 80%, P < .01) compared with the US group. However, the differentiation status of tumors, tumor size, and proportion of resection margin–negative were similar between the two groups.

Karakteristike NACRT US NACRT vs US
N = 40 N = 30 P vrijednost
Age (y) 66 (51-78) 68 (52-84) .44
Male gender 24 (65%) 16 (53%) .28
Pretreatment diagnosis: R/BR/LA 3 (8%)/35 (88%)/2 (5%) 14 (47%)/16 (53%)/0 <.01
Procedure: SSPPD(TP)/DP 31 (79%)/9 (22%) 19 (63%)/11 (37%) .15
Poor differentiation 4 (10%) 0 .07
ypTS 2.7 (0.9-5.5) 2.9 (1.0-4.3) .14
Nodal metastasis 12 (40%) 24 (80%) <.01
Stage IA/IB/IIA/IIB/III 10 (25%)/17 (43%)/1 (3%)/9 (23%)/3 (8%) 3 (10%)/5 (17%)/0/16 (53%)/6 (20%) .01
Treatment effect, Evans grade I/IIA/IIB/III 9 (19%)/20 (50%)/8 (20%)/3 (8%) - -
Resection margin–negative 34 (85%) 23 (77%) .28
Recurrence 28 (70%) 20 (67%) .77
  • Abbreviations: BR, borderline resectable DP, distal pancreatectomy LA, locally advanced NACRT, neoadjuvant chemoradiotherapy R, resectable SSPPD, subtotal stomach-preserving pancreatoduodenectomy TP, total pancreatectomy US, upfront surgery.

3.2 Immune cell distribution according to preoperative treatment

As shown in Figure 2, all immune cells were present in both the cancer stroma and the cancer cell nests of PDAC samples. These cells were found to be more abundant in the cancer stroma than in the cancer cell nest regardless of preoperative therapy. Figure 2 shows a comparison of immune cell distributions between the NACRT and US groups. Although the cancer stromal counts of CD4+ T cells, CD20+ B cells, and Foxp3+ T cells in the NACRT group were drastically decreased compared with those in the US group, these counts in the cancer cell nests were not different between the two groups. In contrast, CD204+ macrophage counts in the cancer stroma were similar between the NACRT and US groups, whereas those in the cancer cell nests were significantly reduced in the NACRT group. PD-L1+ carcinoma cell counts in the NACRT group were substantially lower in comparison with the US group (Table 2). These results suggest that alterations in TIICs following NACRT appear to be very different from those in cancer stromal immune cells.

Characteristics (count/mm 2 ) NACRT US NACRT vs US
N = 40 N = 30 P vrijednost
CD3+ CD4+ T cell (stroma) 77.5 (13.5-365.7) 92.9 (4.9-397.0) .561
CD3+ CD4+ T cell (cancer cell nest) 9.0 (0.0-82.6) 4.4 (0.0-38.2) .056
CD3+ CD8+ T cell (stroma) 77.3 (17.9-418.8) 139.6 (25.2-684.3) .017
CD3+ CD8+ T cell (cancer cell nest) 16.4 (0.0-173.3) 19.7 (3.5-262.1) .367
CD20+ B cell (stroma) 1.3 (0.0-18.9) 16.5 (0.0-253.4) < .001
CD20+ B cell (cancer cell nest) 0.0 (0.0-11.9) 0.0 (0.0-5.6) .100
CD3+ Foxp3+ T cell (stroma) 4.4 (0.0-73.5) 19.4 (0.1-118.6) .005
CD3+ Foxp3 + T cell (cancer cell nest) 0.5 (0.0-17.0) 1.8 (0.0-17.4) .072
CD204+ cell (stroma) 252.4 (53.0-959.6) 278.6 (2.7-693.8) .302
CD204+ cell (cancer cell nest) 16.7 (0.0-137.6) 56.3 (6.1-150.0) .001
PD-L1 high carcinoma 0.0 (0.0-25.4) 2.2 (0.0-521.3) < .001

3.3 Association between TIICs and early recurrence of disease in the NACRT group

The count of each immune cell found in carcinomas was divided into low and high groups according to the cutoff value (set as the median amount). Kaplan-Meier curve analysis demonstrated that only patients with high CD204+ macrophage counts in the cancer cell nest (>16.7 counts/mm 2 ) had significantly shorter RFS times compared with patients with low CD204+ macrophage counts in the cancer cell nest (Figure 3). Univariate and forest plot analyses suggested that high PD-L1 expression and the presence of CD204+ macrophages in the cancer cell nest were associated with shorter RFS (Table 3 and Figure S2). Following multivariate analysis, only high CD204+ macrophage counts in the cancer cell nest remained an independent predictor of shorter RFS (Table 3). There were no significant differences in the basic characteristics between the groups with high and low CD204+ macrophage counts in the cancer cell nest (Table 4).

Variables Univariate Multivariate
MRFS (months) P vrijednost OR (95% CI) P-vrednost
CD3+ CD4+ T cell (cancer cell nest) < 9.0 13.5 .360
>9.0 18.7
CD3+ CD8+ T cell (cancer cell nest) < 16.4 15.2 .622
>16.4 12.9
CD20+ B cell (cancer cell nest) < 0.0 15.2 .747
>0.0 6.6
CD3+ Foxp3+ T cell (cancer cell nest) < 0.5 13.5 .667
>0.5 18.7
CD204+ cell (cancer cell nest) < 16.7 25.0 .032 2.366 (1.074-5.215) .033
>16.7 6.9
PD-L1 high carcinoma (cancer cell nest) < 0.0 22.5 .091 2.001 (0.912-4.390) .084
>0.0 6.9
Karakteristike High CD204+ (cancer cell nest) Low CD204+(cancer cell nest) High vs low
N = 20 N = 20 P-vrednost
Age (y) 66 (51-78) 66 (54-78) .34
Male gender 14 (70%) 10 (50%) .17
Pretreatment diagnosis: R/BR/LA 2 (10%)/16 (80%)/2 (10%) 1 (5%)/19 (95%)/0 .27
Procedure: SSPPD(TP)/DP 31 (79%)/9 (22%) 19 (63%)/11 (37%) .15
Poor differentiation 2 (10%) 2 (10%) 1.00
ypTS 2.5 (0.9-5.5) 3.0 (1.0-4.0) .51
Nodal metastasis 4 (20%) 8 (40%) .17
Resection margin–negative 3 (15%) 3 (15%) 1.00
Recurrence 16 (80%) 12 (60%) .15
  • Abbreviations: BR, borderline resectable DP, distal pancreatectomy LA, locally advanced R, resectable SSPPD, subtotal stomach-preserving pancreatoduodenectomy TP, total pancreatectomy ypTS, pathological tumor size.

Tight Control of Hypoxia-inducible Factor-α Transient Dynamics Is Essential for Cell Survival in Hypoxia

Intracellular signaling involving hypoxia-inducible factor (HIF) controls the adaptive responses to hypoxia. There is a growing body of evidence demonstrating that intracellular signals encode temporal information. Thus, the dynamics of protein levels, as well as protein quantity and/or localization, impacts on cell fate. We hypothesized that such temporal encoding has a role in HIF signaling and cell fate decisions triggered by hypoxic conditions. Using live cell imaging in a controlled oxygen environment, we observed transient 3-h pulses of HIF-1α and -2α expression under continuous hypoxia. We postulated that the well described prolyl hydroxylase (PHD) oxygen sensors and HIF negative feedback regulators could be the origin of the pulsatile HIF dynamics. We used iterative mathematical modeling and experimental analysis to scrutinize which parameter of the PHD feedback could control HIF timing and we probed for the functional redundancy between the three main PHD proteins. We identified PHD2 as the main PHD responsible for HIF peak duration. We then demonstrated that this has important consequences, because the transient nature of the HIF pulse prevents cell death by avoiding transcription of p53-dependent pro-apoptotic genes. We have further shown the importance of considering HIF dynamics for coupling mathematical models by using a described HIF-p53 mathematical model. Our results indicate that the tight control of HIF transient dynamics has important functional consequences on the cross-talk with key signaling pathways controlling cell survival, which is likely to impact on HIF targeting strategies for hypoxia-associated diseases such as tumor progression and ischemia.

Author's Choice—Final version full access.

Both authors contributed equally to this work.

Recipient of a Biotechnology and Biological Sciences Research Council doctoral training studentship.

Holds University of Liverpool studentship.

Recipient of a Medical Research Council capacity building studentship.

Present address: Faculty of Life Sciences, University of Manchester, Manchester M13 9PT, United Kingdom.


Uvod

Skeletal muscles undergo structural and functional adaptations to various stimuli including mechanical (e.g., exercise) and environmental (e.g., systemic hypoxia) stimuli. Endurance exercise training results in improved muscle oxidative capacity (Holloszy and Booth 1976 ), whereas resistance exercise training leads to increases in muscle size and strength (McDonagh and Davies 1984 ). Endurance exercise training (5–6 times/week for 3–6 weeks at 70–80% maximal oxygen uptake) performed in systemic hypoxia induces a greater increase in muscle oxidative capacity when compared to endurance exercise training under normoxia (Desplanches et al. 1993 Geiser et al. 2001 ). This suggests that skeletal muscle adaptations are specific to the type of exercise stimuli, and that the combination of exercise and systemic hypoxia may have a synergistic effect on skeletal muscle adaptations such as muscular endurance.

It is generally recognized that endurance exercise training causes a significant increase in skeletal muscle capillarization, characterized by an elevated capillary density and capillary-to-fiber ratio (Andersen 1975 Brodal et al. 1977 Hudlicka et al. 1992 ). This physiological adaptation contributes to enhanced aerobic capacity via an increase in the transport, conductance, and extraction of oxygen in skeletal muscle. Vascular endothelial growth factor (VEGF) (Folkman and Shing 1992 Hudlicka et al. 1992 van Weel et al. 2004 Olfert et al. 2009 ), the generation of nitric oxide by nitric oxide synthase (NOS) (Baum et al. 2004 , 2013 ), and peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) (Arany et al. 2008 Leick et al. 2009 ) are positive regulators of angiogenesis in skeletal muscle. Among these regulators, VEGF is known to play a critical role in increasing angiogenesis. When compared with wild-type mice, VEGF transgenic mice (van Weel et al. 2004 ) and muscle-specific VEGF knock-out mice (Olfert et al. 2009 ), respectively, have increased and decreased skeletal muscle capillary density. Both NOS (Baum et al. 2013 ) and PGC-1α (Leick et al. 2009 ) knock-out mice have decreased skeletal muscle VEGF expression and capillary-to-fiber ratio. Acute high-intensity resistance exercise (three sets of 10 repetitions of two legged knee extensor exercise at 60–80% of 1RM) in humans increases the expression of skeletal muscle VEGF mRNA and protein (Gavin et al. 2007 ). Hypoxic stimuli in cells also increase VEGF mRNA levels through the activation of the nuclear transcription factor, hypoxia-inducible factor-1 (HIF-1) (Forsythe et al. 1996 ). Thus, it is possible that resistance exercise training under systemic hypoxia, when compared with normoxia, causes a greater increase in skeletal muscle VEGF and capillarization potentially leading to increased muscular endurance.

Therefore, this study investigated the effects of resistance exercise training under systemic hypoxia on the angiogenic response and muscular endurance in human skeletal muscle. We hypothesized that resistance exercise training under systemic hypoxia would lead to a greater development of muscular endurance and greater increase in angiogenic and mitochondrial responses as demonstrated by increases in VEGF, PGC-1α, NOS, and capillary-to-fiber ratio.


4 EXPERIMENTAL PROCEDURES

4.1 Chick embryos

According to Swedish regulations (Jordbruksverkets föreskrift L150, §5) work on chick embryos younger than embryonic day 13 do not require Institutional Animal Care and Use Committee oversight.

4.2 Human and mouse fetal tissue

Human fetal tissue (ethical approval Dnr 6.1.8-2887/2017, Lund University, Sweden) was obtained from elective abortions. Tissue samples were dissected in custom-made hibernation medium (Life Technologies, Carlsbad, California) and fixed in 4% formaldehyde overnight. Following a sucrose gradient, embryos were embedded in gelatin for transverse sectioning at 12 μm (ew5) or 7 μm (ew6) using a cryostat.

4.3 Cell culture

The human neuroblastoma cell line SK-N-BE(2)c (ATCC Manassas, Virginia) was cultured in MEM supplemented with 10% fetal bovine serum and 100 units penicillin and 10 μg/mL streptomycin. As part of our laboratory routines, all cells were maintained in culture for no more than 30 continuous passages and regularly screened for mycoplasma. SK-N-BE(2)c cells were authenticated by SNP profiling (Multiplexion, Germany).

4.4 Embryos and perturbations

Chick embryos were acquired from commercially purchased fertilized eggs and incubated at 37.5°C until desired developmental Hamburger Hamilton (HH) stages were reached. 10 Optimal conditions for high transfection efficiency applying one-sided electroporation in ovo were determined to 5 pulses of 30 ms each at 22 V. Ringer's balanced salt solution (solution-1:144 g NaCl, 4.5 g CaCl•2H2O, 7.4 g KCl, ddH2O to 500 mL solution-2:4.35 g Na2HPO4•7H2O, 0.4 g KH2PO4, ddH2O to 500 mL [adjust final pH to 7.4]) containing 1% penicillin/streptomycin was used in all experiments. Morpholinos used were from GeneTools with the following sequences splice targeting EPAS1 oligo (5′-GAAAGTGTGAGGGAACAAGTTACCT-3′) and a corresponding 5′-mispair oligo (5′-GAtAcTGTcAGGcAACAAcTTACCT-3′). Morpholinos were injected at a concentration of 1 mM and co-electroporated with a GFP tagged empty control vector (1 μg/μL). RFP-tagged EPAS1 overexpression construct or corresponding empty control vector were electroporated at a concentration of 2.5 μg/μL. CRISPR constructs with gRNA nontargeting control (#99140, Addgene) or gRNAs targeting EPAS1 (EPAS1.1.gRNA Top oligo—5′ ggatgGCTCAGAACTGCTCctacc 3′, Bot oligo—5′ aaacggtagGAGCAGTTCTGAGCc 3′ EPAS1.2.gRNA Top oligo—5′ ggatgAAGGCATCCATAATGCGCC 3′, Bot oligo—5′ aaacGGCGCATTATGGATGCCTTc 3′ EPAS1.3.gRNA Top oligo—5′ ggatgAAATACATGGGTCTCACCC 3′, Bot oligo—5′ aaacGGGTGAGACCCATGTATTTc 3′) were cloned into U6.3 > gRNA.f + e (#99139, Addgene) and electroporated at a concentration of 1.5 μg/μL, and accompanying Cas9-GFP (#99138, Addgene) at 2 μg/μL. 40 All constructs were injected at HH stage 10+/11 into the lumen of the neural tube from the posterior end and embryos were electroporated in ovo applying electrodes 4 mm apart, covering the whole embryo. One-sided electroporation was performed to allow for an internal control side within each individual embryo. Embryos were allowed to sit at room temperature for 6 to 10 hours before further incubation of the embryos at 37.5°C in order to allow the Cas9 protein to fold. Importantly, apart for analysis on embryo growth (ie, age determination), all analyses were performed on sections/cells at the trunk axial level of the embryo.

For harvesting of tissue for RNA extraction, embryos were incubated at 37.5°C for 24 (morpholinos and overexpression vectors) or 36 (CRISPR/Cas9) hours postelectroporation. The trunk portion of neural tubes was dissected and immediately snap frozen before RNA extraction and qPCR analysis.

4.5 Cloning

To overexpress HIF-2α, the Gallus gallus EPAS1 coding sequence was amplified using the following primers Fwd:

5′AAACTCGAGGCCACCATGGACTACAAAGACGATGACGACAAGGCAGGTATGACAGCTGACAAGGAGAAG-3′, Rev 5′-AAAGCTAGCTCAGGTTGCCTGGTCCAG-3′ and cloned into the pCI H2B-RFP vector (Addgene plasmid #92398). For CRISPR/Cas9 targeting, oligos designed to target EPAS1 at three different locations (EPAS1.1, EPAS1.2, and EPAS1.3) were annealed pairwise at a concentration of 100 μM per oligo using T4 DNA Ligase Buffer in dH2O by heating to 95°C for 5 minutes. The annealed oligo reactions were cooled to room temperature and diluted. The U6.3 > gRNA.f + e (#99139, Addgene) vector was digested over night with BsaI-HF enzyme (New England Biolabs) and gel extracted. gRNAs were cloned into the digested U6.3 > gRNA.f + e vector using T4 DNA Ligase (New England Biolabs) at room temperature for 20 minutes. Successful inserts were identified by colony PCR using U6 sequencing primer and gRNA reverse oligo specific to each EPAS1 gRNA.

4.6 Neural tube dissections for crestosphere cultures

Neural tubes from respective axial levels were carefully dissected out from embryos at designated somite stages. For cranial-derived cultures, the very anterior tip was excluded, and the neural tube was dissected until the first somite level as previously described. 26 For trunk-derived cultures, the neural tube was dissected between somite 10 to 15 as previously described. 24, 25 Pools of neural tubes from four to six embryos were used for each culture.

4.7 Crestosphere cell culture

Neural tube derived cells were cultured in NC medium (DMEM with 4.5 g/L glucose (Corning), 7.5% chick embryo extract (MP Biomedicals, Santa Ana,California), 1X B27 (Life Technologies), basic fibroblast growth factor (bFGF, 20 ng/mL) (Peprotech, Stockholm, Sweden), insulin growth factor-I (IGF-I, 20 ng/mL) (Sigma Aldrich, Darmstadt, Germany), retinoic acid (RA 60 nM for cranial and 180 nM for trunk, respectively) (Sigma Aldrich), and 25 ng/mL BMP-4 (for trunk) (Peprotech)) in low-adherence T25 tissue culture flasks as described previously. 24, 25

4.8 Self-renewal assay

Chick embryos at developmental HH stage 10+/11 were injected and electroporated with CRISPR/Cas9 constructs and allowed to develop at 37.5°C to reach HH stage 13 + /14 − . Crestosphere cultures were established from embryos electroporated with control, EPAS1.1 or EPAS1.2 constructs. Crestospheres were dissociated into single cells using Accutase (Sigma Aldrich incubation at 37°C for 40 minutes with 1 minute of pipetting every 10 minutes), and individual cells were manually picked using a p10 pipette tip under a microscope. Single cells were transferred to 96-well plates prepared with 100 μL of NC medium supplemented with RA and BMP-4. 25 The absolute number of spheres formed in each well was quantified manually under the microscope. Sphere diameter was manually measured using the ImageJ software (spheres measured n = 33 and n = 27 for CTRL and EPAS1.2, respectively).

4.9 EdU pulse chase labeling

Proliferation was measured using the Click-iT EdU Cell Proliferation kit (Invitrogen #C10337) according to the manufacturer's recommendations with optimizations from Warren et al. 23 Chick embryos at developmental HH stage 10+/11 were injected and electroporated with morpholino or overexpression constructs and allowed to develop for an additional 24 hours at 37.5°C. Eggs were then reopened and EdU solution (500 μM in PBS-DEPC) was added. Eggs were resealed and incubated at 37.5°C for another 4 hours before dissection in Ringer's solution and fixed in 4% paraformaldehyde overnight. Embryos were washed in PBS-DEPC, H2O, and 3% BSA in PBS-DEPC before permeabilization in 0.5% Triton-X. Embryos were hybridized in reaction cocktail (Click-iT Reaction buffer, CuSO4, Alexa Fluor 488 Azide and reaction buffer additive), washed and DAPI stained. Embryos were after another round of washing processed through a sucrose gradient and embedded in gelatin.

4.10 Whole mount in situ hybridization

For whole mount in situ hybridization, embryos were fixed in 4% PFA and washed in DEPC-PBT. Samples were gradually dehydrated by bringing them to 100% MeOH and kept at −20°C until use. In situ hybridization was performed as previously described. 41 Embryos were rehydrated back to 100% PBT, treated with Proteinase K/PBT, washed in 2 mg/mL glycine/PBT and postfixed in 4% paraformaldehyde/0.2% glutaraldehyde for 20 minutes. Embryos were then prehybridized in hybridization buffer for 2 hours at 70°C and hybridized with Digoxigenin (DIG)-labeled TFAP2B probe overnight at 70°C. Embryos were washed in wash solutions I and II (50% formamide, 1% sodium dodecyl sulfate [SDS] and 5X SSC [NaCl and Na citrate] or 2X SSC, respectively), and blocked in 10% sheep serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST/1% sheep serum overnight at 4°C. On day 3, embryos were washed in TBST throughout the day and overnight. Embryos were washed in alkaline phosphatase buffer (NTMT 100 mM NaCl, 100 mM Tris-Cl [pH 9.5], 50 mM MgCl2, 1%Tween-20) before visualizing the signal using NBT/BCIP (Sigma Aldrich). Stained embryos were rinsed in PBT for 20 minutes and postfixed in 4% PFA/ 0.1% glutaraldehyde overnight when considered complete. Embryos were then dehydrated in MeOH to be stored at −20°C. Embryos were later embedded in blocks of gelatin for transverse sectioning at 8 μm using a cryostat. Hybridization probe for avian TFAP2B was a kind gift from Dr Felipe Vieceli.

4.11 RNA sequencing

Chick embryos of stage HH10+/11 were from the posterior end injected with EPAS1 targeting or corresponding 5′-mispair morpholinos into the lumen of neural tubes and subsequently electroporated for construct uptake. Following 24 hours of incubation at 37.5°C, embryos were removed from the eggs in Ringer's solution. The neural tube portion at the trunk axial level of individual embryos were carefully dissected, removing surrounding mesodermal tissue, and transferred to Eppendorf tubes (neural tube tissue from one embryo per Eppendorf) that were snap frozen. RNA was extracted from each individual neural tube (five samples per condition [EPAS1 and 5′-mispair, respectively]) using the RNAqueous Micro Kit (Ambion, #AM1931). Sequencing was performed using NextSeq 500 (Illumina). Alignment of reads was performed using the HISAT2 software and the reference genome was from the Ensemble database (Gallus gallus 5.0). Expression counts were performed using the StringTie software and DEG analysis was performed using DESeq2. To obtain a relevant working list out of the 1105 significantly DEGs, we set a cut-off at P < .005 and removed all hits that were NA, ending up with 97 genes. Značaj (P values) was DESeq2 derived. 42 RNA sequencing data have been deposited in NCBI's Gene Expression Omnibus 43 and are accessible through GEO Series accession number GSE140319.

4.12 Bioinformatics

GSEA for gene ontology, network and functional analyses were generated through the use of Panther database (analyses performed autumn 2018 (http://pantherdb.org/) 44 together with the Ingenuity Pathway Analysis (IPA) software 45 (QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis). For a hypothesis-free/exploratory analysis of the 97 DEGs, IPA was used (P-value calculations using right-tailed Fisher Exact Test). IPA was mainly used for deeper exploration of the data where the biological hypotheses generated for the project were further explored. Here, a hypotheses-driven approach was taken where the following categories found from the IPA analysis of the 97 DEGs were further investigated “Cellular Movement,” within the “Molecular and Cellular Function” result category, “Embryonic Development,” within the category “Physiological System Development and Function,” and “Tumor Morphology,” within the “Disease and Disorders” category. These three biological networks were further investigated within the data set at hand. The investigation for the possible overlap and connections between these networks in the context of the data were hence explored.

4.13 Cryosections

Fixed embryos were incubated in a sucrose gradient (5% sucrose for 10 minutes and 15% sucrose for 10 minutes up to several hours) followed by incubation in 7.5% gelatin over night at 37°C. Gelatin embedded samples were cryosectioned at 7 to 20 μm.

4.14 Immunohistochemistry and immunofluorescence

Immunohistochemistry on mouse fetal tissue for HIF-2α (NB100-132, Novus Biologicals) and TH (ab112, Abcam) was performed using Autostainer (Dako). Sections were counterstained with hematoxylin. Detection of HIF-2α by immunofluorescence was performed on sections from the trunk axial level of embryos (avian and human) that had been harvested, fixed as whole embryos in 4% PFA overnight, incubated in 5% sucrose for 10 minutes, 15% sucrose for 4 hours and gelatin overnight. Embryos were then embedded in gelatin and snap frozen. Dry embryo sections were incubated in ice-cold acetone followed by 0.3% Triton-X in PBS. After washing in PBS, slides were blocked in DAKO serum-free ready-to-use block (DAKO, #X0909) for 1 hour before incubation with primary antibodies (in DAKO antibody diluent with background reducing components [DAKO, #S3022]) overnight (HIF-2α, ab199, Abcam HNK-1, 3H5, DSHB). Slides were washed in PBS and incubated with rabbit linker (DAKO, #K8019) followed by secondary antibody in 1% BSA/PBS. Detection of HNK1 and SOX9 by immunofluorescence was performed by blocking (10% goat serum and 0.3% Triton-X in TBST) of embryo sections followed by incubation with primary antibodies (SOX9, ab5535, Millipore) over night at +4°C. Slides were washed and incubated with secondary antibodies and DAPI for nuclear staining for 1 hour at RT before washing and mounting. Fluorescent images were acquired using an Olympus BX63 microscope, DP80 camera, and cellSens Dimension v 1.12 software (Olympus Cooperation). Detailed information on antibodies can be found in Table 6.

Vrste Razblaživanje Izvor Product #
IF antibodies
Primary antibody
HNK1 Miš 1:5 Hybridoma bank 3H5
HIF-2α Rabbit 1:50 Abcam ab199
SOX9 Rabbit 1:1000 Millipore ab5535
Secondary antibody
Anti-mouse Alexa Fluor-594 Goat 1:1000 Invitrogen A-11032
Anti-rabbit Alexa Fluor-546 Donkey 1:1000/1:500 Invitrogen A-10040
Anti-mouse Alexa Fluor-488 Goat 1:1000 Invitrogen A-11008
IHC antibodies
Primary antibody
HIF-2α Miš 1:1000 Novus Biologicals NB100-132
HIF-2α Rabbit 1:4000 Abcam ab199
TH Rabbit 1:1600 Abcam ab112
In situ antibodies
Anti-dig-AP Miš 1:2000 Roche Diagnostics 11 093 274 910
Nuclear staining
DAPI 1:3000 Dako D3571
Western blot antibodies
Primary antibody
HIF-2α Rabbit 1:200 Abcam ab199
SDHA Miš 1:4000 Abcam ab14715
Secondary antibody
Anti-rabbit Monkey 1:3000 Invitrogen 65-6120
Anti-mouse Ovce 1:5000 Invitrogen 62-6520

4.15 Western blot

Extracted proteins were separated by SDS-PAGE, transferred to HyBond-C-Extra nitrocellulose membranes, blocked, and incubated with primary antibodies (HIF-2α, ab199, Abcam SDHA, ab14715, Abcam) at 4°C overnight. The next day, membranes were incubated with HRP-conjugated antibodies and proteins detected by ECL solution. Detailed information on antibodies can be found in Table 6.

4.16 RNA extraction and quantitative real-time PCR

Total RNA was extracted using the RNAqueous Micro Kit (Ambion, #AM1931). cDNA synthesis using random primers and qRT-PCR was performed as previously described. 27 Relative mRNA levels were normalized to expression of two reference genes (18S, 28S) using the comparative Ct method. 46 Detailed information of primer sequences can be found in Table 7.

Target gene 5′-3′
18S (reference gene) Fwd CCATGATTAAGAGGGACGGC
Rev TGGCAAATGCTTTCGCTTT
28S (reference gene) Fwd GGTATGGGCCCGACGCT
Rev CCGATGCCGACGCTCAT
EPAS1 Fwd GGCACCAATACCATGACGA
Rev CATGTGCGCGTAACTGTCC
SOX10 Fwd AGCCAGCAATTGAGAAGAAGG
Rev GAGGTGCGAAGAGTTGTCC
B3GAT1 Fwd TTGTGGAGGTGGTGAGGA
Rev GGCTGTAGGTGGGTGTAATG
TFAP2B Fwd CCCTCCAAAATCCGTTACTT
Rev GGGGACAGAGCAGAACACCT
HOXC9 Fwd TAAGCCACGAAAACGAAGAG
Rev GAAGGAAAGTCGGCACAGTC
HOXA2 Fwd AGGCAAGTGAAGGTCTGGTT
Rev TCGCCGTTCTGGTTCTCC
NGFR Fwd AGCAGGAGGAGGTGGAGAA
Rev CCCGTGTGAAGCAGTCTATG
HES6 Fwd GCTGATGGCTGATTCCAAAG
Rev TCGCAGGTGAGGAGAAGGT
AGPAT4 Fwd TGCTGGGCGTTCTAAATGG
Rev ACACTCCTGCTCATCTTCTGG
HES5 Fwd GTATGCCTGGTGCCTCAAA
Rev GCTTGTGACCTCTGGAAATG
RASL11B Fwd GCTGGGCTGTGCTTTCTATG
Rev GGTGCTGGTGGTCTGTTGTT
FMN2 Fwd CCATCAGCCAGTCAAGAGGA
Rev TAAAGCATCGGGAGCCAAAC
TAGLN3 Fwd AGGCAGCATTTCCAGACC
Rev ATGGGTTCGTTTCCCTTTG
NRCAM Fwd TCATTCCGTGTGATTGCTGT
Rev AAGGATTTTCATCGGGGTTT
EGFP Fwd CCGACCACTACCAGCAGAAC
Rev TTGGGGTCTTTGCTCAGG

4.17 RNAi experiments

SK-N-BE(2)c cells were transfected with ON-TARGETplus Nontargeting Control siRNA #2 (D-001810-02-05), ON-TARGETplus siRNA Targeting human HIF1Α (J-004018-07) or ON-TARGETplus siRNA Targeting human EPAS1 (J-004814-06), all from Dharmacon, using Lipofectamine 2000 or RNAiMAX. Cells were then placed in 21% or 1% oxygen for 48 hours before harvest. SK-N-BE(2)c cells were treated with 200 μM 2,2′-dipyridyl (DIP), an iron chelator that promotes stabilization of HIF-α at normoxic conditions for 4 hours before harvest and were used as positive control for western blot detection of HIF-2α.

4.18 Oxygen sensing

Oxygen concentrations were measured through the trunk region of developing chick embryos ex ovo within 30 minutes from dissection using microsensors in a flow system of MQ water. We performed trials to confirm that oxygen concentrations are largely stable within the tissue ex ovo over at least 5 hours. Microprofiles were measured in 50 embryos in developmental stages HH10 to HH24. Embryos were removed from the egg using filter paper as described in Mohlin and Kerosuo, 24 submerged in a plate with constant flow of newly shaken MQ of room temperature, and immediately measured. Oxygen microsensors were constructed and calibrated as described by Revsbech and Andersen, 47 mounted on a micromanipulator. The microsensor was manually probing the trunk region and data logged every second. Within the microprofile, 10 consecutive data points of the lowest oxygen concentrations were averaged and set as representing the trunk neural tube. A two-point calibration was performed using the newly shaken MQ (100% oxygen saturation) and by adding sodium dithionite to nonflowing MQ in the plate after measurements (0% oxygen saturation). Salinity of the tissue was determined using a conductivity meter (WTW 3110) and room temperature noted. The tissue is considered a liquid, where full oxygen saturation at 5‰ salinity and 25°C corresponds to 250 μm/L, 160 mmHg, or 21% atmospheric O2. Data were averaged for each HH stage including one measurement of the previous and subsequent HH stages. Replicates vary from 3 to 10 biologically independent data points. Data are presented as percent of maximum saturation in the solution of the specific temperature and salinity.

4.19 Quantifications

Embryonic development was quantified in two ways by determining the HH stage of embryos in ovo using head and tail morphology or by counting the number of somites of dissected embryos ex ovo. The number of embryos (n) for each group is denoted in respective figure legend. The fraction of proliferating EdU + cells was determined by quantifying the number of GFP + proliferating cells as well as RFP + construct targeted cells and dividing the number of double positive cells with the number of RFP + only cells. Premigratory and recently delaminated trunk neural crest cells were included (distinguished by the dotted line in figures). Quantification of migration was performed by calculating the area of detected HNK1 using the ImageJ software. The area of HNK1+ on the electroporated side of the embryos was normalized to that of the control side of the same embryo.

4.20 Statistical methods and data sets

One-way analysis of variance or two-sided student's unpaired t test was used for statistical analyses. For downstream analysis on the 97 DEGs where the software IPA was used, the statistical tests considered were P-value calculations using right-tailed Fisher exact test.


Uvod

In the early 20th century, after extensive studies of the ovine fetal circulation, Sir Joseph Barcroft (1872-1947) postulated that the environment in which the human fetus develops would be comparable to that likely endured by an adult on the summit of Mount Everest [1, 2]. He termed this intriguing hypothesis 'Everest in utero' and proposed that to survive the hypoxic uterine environ ment the fetus must develop elaborate physiological strategies comparable to those seen in climbers ascending the great Himalayan peaks.

In 2007, four climbers descending from the summit of Mount Everest (8,848 meters) took arterial blood gases from one another at 8,400 meters above sea level. Their mean arterial partial pressure of oxygen (PaO2) was 3.28 kPa (24.6 mm Hg) with a mean calculated arterial oxygen saturation (SaO2) of 54% while they rested without supplemental oxygen [3]. Among this group, one individual had a PaO2 of 2.55 kPa (19.1 mm Hg), the lowest PaO2 ever reported in an adult human. So how far removed from intrauterine life were these measurements, and do climbers exhibit, as does the fetus, physiological strategies that may benefit the similarly hypoxemic critically ill patient?


Nanoparticles for Targeting Intratumoral Hypoxia: Exploiting a Potential Weakness of Glioblastoma

Extensive hypoxic regions are the daunting hallmark of glioblastoma, as they host aggressive stem-like cells, hinder drug delivery and shield cancer cells from the effects of radiotherapy. Nanotechnology could address most of these issues, as it employs nanoparticles (NPs) carrying drugs that selectively accumulate and achieve controlled drug release in tumor tissues. Methods overcoming the stiff interstitium and scarce vascularity within hypoxic zones include the incorporation of collagenases to degrade the collagen-rich tumor extracellular matrix, the use of multistage systems that progressively reduce NP size or of NP-loaded cells that display inherent hypoxia-targeting abilities. The unfavorable hypoxia-induced low pH could be converted into a therapeutical advantage by pH-responsive NPs or multilayer NPs, while overexpressed markers of hypoxic cells could be specifically targeted for an enhanced preferential drug delivery. Finally, promising new gene therapeutics could also be incorporated into nanovehicles, which could lead to silencing of hypoxia-specific genes that are overexpressed in cancer cells. In this review, we highlight NPs which have shown promising results in targeting cancer hypoxia and we discuss their applicability in glioblastoma, as well as possible limitations. Novel research directions in this field are also considered.

Ovo je pregled sadržaja pretplate, pristup preko vaše institucije.


Pogledajte video: policajka sa zeleznicke stanice (Decembar 2022).