Informacije

Metode za variranje veličine umetka u klonovima E. coli

Metode za variranje veličine umetka u klonovima E. coli


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Pišem prijedlog magistarskog rada i moram poboljšati ponašanje rješenja nekih krnjih proteinskih domena koje su prethodno pokazale slabu rastvorljivost kada su izražene u E. coli.

Kako bih spriječio ovu neželjenu agregaciju, jedan eksperiment koji ću izvesti bit će izmjena granica domene. Stvorit ću genske konstrukte u kojima će svaki klon imati A domenu određene dužine i granice domene (vidi dolje).

Moje pitanje: Da li je kloniranje Gatewaya bolje od metoda restrikcije/ligaze za ovo? Ako koristim metode restrikcije/ligaze za konstruiranje vektora za transformaciju, moj izbor za granice domena bit će određen restrikcijskim mjestima. Međutim, sa sistemom poput kloniranja Gatewaya, mogu definirati granične granice bp rezolucije jednostavnim definiranjem odgovarajućeg početnog sloja.

Je li moje obrazloženje ovdje ispravno? Moram opravdati svoje izbore za eksperimentalni dizajn istraživačima, pa se želim uvjeriti da sam efikasan i logičan.


Da. U principu, imat ćete znatno povećanu sposobnost prilagođavanja granica svake proteinske domene pomoću pristupa zasnovanog na PCR -u i PCR -u. Nije mi očigledno da je Gateway Cloning System neophodan, ili nužno najbolji izbor za ovaj pristup, ali to je verovatno subjektivno.

Jeste li upoznati sa naporima SGC -a (Konstrucij za strukturnu genomiku) ili ste mu svjesni? Moje razumijevanje (sada već zastarjelo) je da su namjeravali osmisliti/koristiti poluautomatski način implementacije strategije o kojoj govorite (skraćivanje domene) kako bi nam mogli omogućiti pristup velike propusnosti za definiranje uvjeta kristalizacije za njihove ciljeve. Možda biste mogli prilagoditi njihovu metodu (e) svom proteinu od interesa?


Konstrukcija biblioteka genomske DNK sa malim umetcima, visoko obogaćena za mikrosatelitske ponavljajuće sekvence

Opisujemo efikasnu metodu za izgradnju genomskih biblioteka malih umetaka obogaćenih za visoko polimorfne, jednostavne ponavljanja sekvenci. Ovim pristupom proizvode se biblioteke u kojima 40-50% članova sadrži (CA) n ponavljanja, što predstavlja približno 50-godišnje obogaćivanje u odnosu na konvencionalne biblioteke genomske DNK s malim umetcima. Ukratko, genomska biblioteka s prosječnom veličinom umetka manjom od 500 parova baza konstruirana je u fagemidnom vektoru. Pojačanje ove biblioteke u nepotrebnom soju Escherichia coli omogućilo je oporavak biblioteke kao zatvorene kružne jednolančane DNK sa uracilom koji je često ugrađen umjesto timina. Ova DNK je korištena kao šablon za sintezu drugog lanca DNK, prajmirana sa (CA) n ili (TG) n oligonukleotidima, na povišenim temperaturama pomoću termostabilne DNA polimeraze. Transformacija ove mješavine u sojeve divljeg tipa E. coli rezultirala je oporavkom produkata prajmera kao posljedica snažne genetske selekcije protiv jednolančanih molekula DNK koji sadrže uracil. Na ovaj način je pronađena biblioteka bogata obogaćenim ciljanim klonovima koji sadrže mikrosatelite. Ovaj pristup je široko primjenjiv i može se koristiti za generiranje biblioteka odabranih markera koje nose bilo koju jednostavnu sekvencu ponavljanja iz cDNK, cijelih genoma, pojedinačnih hromozoma ili više ograničenih hromozomskih regiona od interesa.


Pozadina

Konstruisane konstrukcije nalaze se u osnovi mnogih eksperimentalnih tehnika u genetici i genomici. Na primjer, ciljana perturbacija genske funkcije korištenjem RNA interferencije ili CRISPR/Cas9 omogućava objedinjene genetske ekrane u cijelom genomu koji se mogu očitati kroz sekvenciranje sljedeće generacije (NGS) male RNA (shRNA) [1, 2] ili sintetičke vodeće RNK (sgRNA) [3,4,5,6] konstrukcije, ili pridružene oznake sekvence/barkodove [7]. Prijenosni elementi se također uobičajeno koriste za mutiranje ili na drugi način manipuliranje genetskim lokusima, a na sličan način omogućuju zaslone mutageneze zasićenja na genomskoj skali u kojima se mjerenje spoja transpozona i genoma mjeri pomoću NGS-a [8]. Pristupi praćenju loza [9, 10] i povezivanja [11, 12] također se oslanjaju na kvantifikaciju molekularnih oznaka zasnovanu na NGS-u. U svim ovim pristupima, amplifikacija polimeraznom lančanom reakcijom (PCR) koristi se za obogaćivanje oznaka sekvence i za dodavanje adaptera i drugih funkcija (npr. Bar kodova za uzorak) potrebnih za sekvenciranje. Međutim, PCR unosi pristranost u ova mjerenja. Oznake sekvence koje se sastoje od shRNA, sgRNA, spojeva transposon-genom ili sintetičkih bar kodova mogu se razlikovati po primarnom slijedu i biofizičkim svojstvima, koja, zajedno s drugim varijablama, poput koncentracije šablona i uvjeta PCR-a, mogu utjecati na efikasnost pojačanja na nepredvidive načine [13, 14,15]. Dodavanje jedinstvenih molekularnih identifikatora (UMI) može ublažiti neke od ovih pristrasnosti, ali povećava složenost pripreme i analize biblioteke [16, 17]. Drugi pristupi, poput kapljične digitalne PCR (ddPCR) i NanoString analize, mogu se koristiti za prevladavanje kvantitativnih netočnosti povezanih s mjerenjem konstruiranih genetskih konstrukata [18, 19]. Instrument NanoString nCounter koristi hibridizaciju fluorescentno bar kodiranih sondi za brojanje kopija ciljnih molekula u uzorku. ddPCR postiže visoku preciznost razdvajanjem pojedinačnih molekula u kapljice emulzije i brojanjem broja kapljica sa i bez amplifikacije, čime se digitalizuje PCR i uklanja pristranost amplifikacije iz procesa kvantifikacije. Međutim, ddPCR i NanoString analiza, iako su vrlo precizne, nemaju propusnost i rezoluciju koju pruža NGS.

Razvili smo novu metodu, REcount (Restrikcija Enzim omogućen counting) za kvantifikaciju oznaka sekvence povezanih sa konstruisanim konstruktima koja je jednostavna za implementaciju i omogućava direktno brojanje potencijalno ogromnog broja oznaka sekvence zasnovano na NGS-u. U ovom pristupu, DNK barkod sa Illumina adapterom se oslobađa digestijom sa MlyI (restrikcijski enzim tipa IIS koji proizvodi molekule s tupim krajem) i sekvenciran za direktno brojanje obilja molekula predloška (slika 1a). Pokazali smo da je REcount mjerenje podložno multipleksiranju korištenjem pet ortogonalnih restrikcijskih enzima, pristup koji se vjerovatno dalje može generalizirati na druge enzime.

REcount omogućava precizna i precizna mjerenja bazena plazmida. a Projektiranje REcount konstrukata. Konstrukt Illumina adaptera koji sadrži barkod oslobađa se restrikcijskim enzimom (MlyI) digestirati i direktno sekvencirati. b Tačnost i ponovljivost RE računa. c Analogna mjerenja istog bazena plazmida prikazana na ploči b koristeći različite brojeve ciklusa PCR -a. d Koren srednjeg kvadrata odstupanja od očekivanih vrijednosti (5% po konstrukciji) kada se bazen plazmida mjeri pomoću REcount -a, te različiti ciklusi PCR amplifikacije bilo konstrukcije bar koda (BC) ili druge varijabilne sekvence u ovim plazmidima (V4). e Pearsonova toplotna karta korelacije upoređujući mjerenja ponovnog brojanja sa digitalnim PCR podacima kapljica i sa konvencionalnim PCR amplifikacijom BCC ili V4 amplikona

Koristili smo REcount za dizajniranje skupa standarda sintetičke DNK koji se mogu koristiti za procjenu pristranosti klastera zbog duljine molekula na sekventima Illumina i pokazali da postoje značajne razlike u pristranosti veličine između različitih instrumenata Illumine. Konkretno, molekuli u bibliotekama za sekvenciranje DNK su sistematski i često znatno ili previše zastupljeni ili različito zastupljeni na različitim modelima sekvencera Illumine na način povezan s dužinom molekula. Konačno, procjenjujemo utjecaj pristranosti veličine u nekoliko uobičajenih primjena NGS-a, uključujući transkriptomska mjerenja (RNA-Seq [20]), genotipizaciju smanjene zastupljenosti (RAD-Seq/GBS [21]) i pristupačno profilisanje kromatina (ATAC- Seq [22]).


Predavanje 17: Rekombinantna DNK 3

Preuzmite video sa iTunes U ili Internet arhive.

Obrađene teme: Rekombinantna DNK 3

Instruktori: Prof. Eric Lander

Predavanje 10: Molekularni biolo.

Predavanje 11: Molekularni biolo.

Predavanje 12: Molekularni biolo.

Predavanje 13: Regulacija gena

Predavanje 14: Lokalizacija proteina.

Predavanje 15: Rekombinantna DNK 1

Predavanje 16: Rekombinantna DNK 2

Predavanje 17: Rekombinantna DNK 3

Predavanje 18: Rekombinantna DNK 4

Predavanje 19: Ćelijski ciklus/znak.

Predavanje 26: Nervni sistem 1

Predavanje 27: Nervni sistem 2

Predavanje 28: Nervni sistem 3

Predavanje 29: Matične ćelije/klon.

Predavanje 30: Matične ćelije/klon.

Predavanje 31: Molekularni medic.

Predavanje 32: Molekularna evolucija.

Predavanje 33: Molekularni medic.

Predavanje 34: Ljudski polimorf.

Predavanje 35: Ljudski polimorf.

Dobro jutro. Dobro jutro.

Ne znam za vas, ali ne mogu više ovako izdržati.

Priznajem, toliko noći zaredom ništa nisam uradio, ali kakva utakmica! Koliko vas je gledalo igru? Odlično.

Vrlo dobro, vrlo dobro. Imate svoje prioritete ravno u svijetu. Veoma dobro. Pa, ako je moguće skrenuti misli s Curta Schillinga sinoć, i što je još važnije večeras.

Možda bismo mogli da provedemo malo vremena jutros u međuvremenu sa bilo kojim rezervnim neuronima koje imate govoreći o rekombinantnoj DNK, u redu? Ono o čemu smo prošli put razgovarali bili su različiti načini kloniranja vašeg gena na osnovu njegovih svojstava. Započeli smo s kloniranjem komplementacijom, zar ne, idejom da ako uzmete biblioteku klonova, moći ćete je staviti u bakteriju i odabrati bakteriju čiji je fenotip obnovljen zahvaljujući posjedovanju plazmida. Vi biste upotpunili nedostatak.

Našli biste klon koji ste htjeli jer je nadopunio nedostatak.

To je sjajno ako ga možete staviti u organizam koji ima kvar.

Možete to učiniti s bakterijama. To možete učiniti s kvascem.

Teže je to učiniti s velikim organizmima jer ih ne možete ubrizgati dovoljno s različitim klonovima da to učinite praktičnim ako ne radite na ćelijskoj kulturi ili nekom vrlo malom organizmu koji brzo raste. Razgovarali smo o mogućnosti korištenja proteinske sekvence, obrnutom prevođenju te proteinske sekvence u računaru iz aminokiselinske sekvence u nukleotidnu sekvencu i korištenju nukleotidne sekvence za dizajniranje sonde za hibridizaciju natrag u genom. To dobro funkcionira ako imate proteinsku sekvencu.

Ali posljednja tema o kojoj smo jutros ponovno htjeli dotaknuti bila je pretpostavka da ste pokušavali klonirati gen koji uzrokuje određenu ljudsku bolest, a nemate pojma koji je to protein. Zatim, ne možete koristiti njegovu sekvencu aminokiselina jer nemate protein. Što možete učiniti kada znate samo da imate gen koji uzrokuje genetski defekt koji uzrokuje bolest? Rekao sam da ga možete klonirati koristeći ideje genetskog mapiranja, položaja, stvari koje je Sturtevant razvio. Dotaknuo sam se toga ukratko i želim ga se samo još malo dotaknuti jer su neki ljudi imali nekoliko pitanja o tome. Postavio sam vrlo jednostavan primjer da vam to pokažem. Pretpostavimo da, da bismo to olakšali, prvo radimo u voćnoj mušici. Radimo na drosofili i pretpostavimo da je prava slika hromozoma u osnovi ovakva.

Postoji lokus koji može imati ili mutirani alel M ili alel divljeg tipa plus. Postoji hrpa drugih lokusa duž hromozoma. Pretpostavimo da znamo gdje su i sve to. I, imaju dva alternativna alela. Na ovom mestu aleli su narandžasti ili ružičasti. Na ovom lokusu nazvat ću alele narandžasti ili ružičasti.

Ovo su različiti lokusi. To su različiti aleli. Upravo sam ih nazvao narančastom i ružičastom u oba slučaja pa nemam dugu boja ovdje da nas zbuni. Ali sve što želim reći je da postoje dva moguća alela ovdje, dva alela ovdje, dva alela ovdje.

Ovo je oboljeli gen koji nas zanima, a ovo su pasivni markeri. Ovo su drugi markeri duž hromozoma. Ako bismo postavili križanje između heterozigota, ovdje heterozigota i heterozigota, a bilo je slučaj da smo na kromosomu koji nosi mutantni alel, dogodilo se da na ova tri markera imamo narančaste alele. Ne znam šta su, ali šta god da su ovi narandžasti aleli, oni bi mogli biti vidljivi fenotip, račvasti ili žuti ili sa čekinjama. To mogu biti razlike u sekvenci DNK. Mogli bi biti što god želite, ali pretpostavimo da M kromosom ima skup alela koji su na svakoj lokaciji različiti od plus kromosoma. Zatim, kada pogledamo potomstvo koje je proizašlo iz ovog križa, samo zbog jednostavnosti pogledajmo one potomke koji su homozigotni mutanti.

Pa, generalno, ako ovde nije bilo ukrštanja, onda će M hromozom imati narandžastu, narandžastu, narandžastu, narandžastu, narandžastu, narandžastu. Međutim, ako je došlo do ukrštanja, moglo bi biti narandžasto, narandžasto, ružičasto na jednom od tih hromozoma. Ili ako je bilo ovakvih ukrštanja, moglo bi biti narandžasto, narandžasto, roze na jednom hromozomu i narandžasto, roze, roze na drugom hromozomu. Moglo je čak, u krajnjem slučaju, imati križanja vrlo blizu gena, možda ovdje, pa čak i ovdje. I imate narandžastu, roze, roze, i roze, roze, roze.

Ali ako pogledamo mnoge segregacije, iz genetskog mapiranja znate da što je lokus bliži genu bolesti, to će naslijeđe biti čvršće korelirano, to će veza biti čvršća. Ovo nije ništa drugo do mapiranje veza. Ali sada, pretpostavimo da radimo mapiranje veza, ali argumentacije radi, cijeli genom je već bio sekvenciran. Pretpostavimo da je genom sekvenciran u ukrštanju i da je cijeli genom voćne mušice sekvenciran tako da je sekvenciran.

Pogledali smo krst i pogledali mutante.

I ono što smo uradili je da smo isprobali različite pozicije duž genoma.

I na svakoj poziciji smo imali neki genetski marker.

A taj genetski marker mogao bi biti jednostavan kao i činjenica da na tom mjestu možda postoji A u DNK sekvenci na jednom od kromosoma, a možda i ne znam G u drugom nizu.

A ovde, ovaj marker bi mogao biti, postoji T na nekoj određenoj poziciji, a postoji C na nekoj određenoj poziciji.

Kada bismo to mogli ispitati, kada bismo mogli reći, mogli bismo pogledati da li je ova varijacija pravopisa usko povezana s mutantom.

A ova varijacija pravopisa usko je povezana sa nasljeđivanjem mutantnog alela. Mogli bismo samo pokušati gore -dolje genom, različita mjesta pravopisnih razlika kao da su genetski markeri u našem križu, jer su to genetski markeri u našem križu, i vidjeti koji je od njih najuže povezan.

Onog trenutka kada dobijemo bilo kakvu razliku u genetskom nizu, koja pokazuje vezu su-nasljeđivanja u ovom križu, znamo da ovo mjesto u genomu mora biti u blizini naše mutacije.

Dakle, mi ćemo pokušati bliže, a mi ćemo pokušati s druge strane.

Ono što radite je da testirate genetske varijacije, prvo da pronađete ono koje pokazuje bilo koje sunasljedstvo.

A kad to dobijete, isprobajte sve bliže, i bliže, i bliže. Prošli put sam govorio o procesu, ako imate jedan od tih markera, mogli biste ga upotrijebiti za izolaciju sljedećeg klona i sljedećeg klona i sljedećeg klona. Ali znate šta sam shvatio? To je tako staromodno. Mogli bismo se pozabaviti i činjenicom da imamo sekvencu genoma. Više ne biste nikada izolirali sljedećeg klona i sljedećeg klona i sljedećeg klona.

Samo pogledaj u kompjuteru. Dakle, čak i ako imate cijeli niz genoma, moramo otkriti koji je dio njega naslijeđen zajedno s ovom bolešću, i to je način na koji to radite, u redu? Genetsko mapiranje, kako ga je Sturtevant izmislio, može se primijeniti ako imate cijeli niz genoma i dovoljno mjesta varijacije. I, nacrtao sam ga za ukrštanje voćne mušice, ali i ovo bi mogla biti cistična fibroza.

Jedina razlika je ako ovo radimo u ljudskim porodicama, a radi se o cističnoj fibrozi, nemamo toliko potomaka.

Dakle, moramo prikupiti podatke iz mnogih porodica. I, ne možemo to urediti tako da svaka porodica ima potpuno iste narandžaste alele ovdje gore i ružičaste alele dolje, ali kompjuteri se mogu nositi s tim. Oni još uvijek mogu otkriti korelaciju u mnogim porodicama, a vi ćete pronaći mjesto u genomu gdje za mnoge, mnoge, mnoge porodice djeca koja su sva dobila bolest pokazuju korelirano nasljeđe sa ovim markerom. I to vas na kraju vezuje za regiju genoma. Privezuje vas na one genetske markere koji pokazuju apsolutno najužu korelaciju, usku korelaciju, i tu gledate.

Na taj način, ljudi su 1984. mogli mapirati lokaciju Huntingtonove bolesti da bi do sada mapirali lokacije više od 100 različitih ljudskih genetskih bolesti na kojima ljudi nisu unaprijed poznavali proteine. Učinili su to u potpunosti na osnovu ovog pozicionog mapiranja. Dakle, Sturtevantova ideja, koja mi se toliko sviđa, sada se tako lijepo odigrala u području moderne molekularne medicine. UREDU. Dakle, naprijed.

Želim da pričam o nekoliko drugih varijacija na ovu temu prilično brzo, a onda mislim da želim da pričam o tome kako analizirate svoje klonove. Prvo, varijacije kloniranja, trebao bih barem to spomenuti. Govorili smo o kloniranju u autonomno replicirajućem plazmidu u bakteriji.

Dakle, idete na bakteriju. Imaju neke autonomno replicirane dijelove DNK. Postoje krugovi. Možete klonirati u njima, i obično možete, ove stvari su reda veličine, ne znam, 1.000 do 2.000 do 5.000 baza može se lako klonirati u ovim plazmidima. Možete učiniti više, ali to je tipična vrsta broja, obično veličina umetka. Ali mi u laboratoriji idemo do mnogo većih brojeva, poput 10.000 ponekad. Također možete, ako ste htjeli proučavati kvasac, ispostaviti se da kvasac također ima plazmide, a možete učiniti i slične stvari za kvasac.

Ispostavilo se da umjesto plazmida možete koristiti bakterijske viruse. Ovi bakterijski virusi imaju sve različite oblike kao što smo već govorili, kružne ili linearne, i obično mogu zadržati, oh, 15.00-40.000. Neki od ovih virusa su prilično veliki.

Lambda bakteriofaga ima tendenciju nositi mnogo stvari.

I, može se replicirati. Dakle, mogli biste učiniti istu stvar s tim. Možete čak koristiti viruse koji inficiraju stanice sisara i sada postoje razne vrste virusa koje ljudi ponovo kloniraju, linearni ili kružni. Ne znam, za ćelije sisavaca često imate viruse poput 1.000-5, 00. Sada čak možete napraviti i cijele vještačke hromozome. To možete učiniti u kvascu.

Umjetni hromozomi se nazivaju YACs. Imaju svu malu mašineriju, male telomere na sebi, male centromere. Imaju marker koji se može odabrati, i onda u njega možete klonirati svoj dio DNK. A to može zauzeti i do milion baza DNK.

Dakle, ako želite, postoje bakterijski umjetni kromosomi.

Zovu se BAC ako su u bakterijama. Nedavno su ljudi razvili umjetne kromosomske sisteme za ćelije sisavaca, a posebno za ljudske ćelije. I nažalost se zovu MAC -ovi i HAC -i i slično. U osnovi, svaki molekul koji se može replicirati u bilo kojem sistemu, neki pametni molekularni biolog će doći i reći, kako da to iskoristim u svoju svrhu, da ubacim svoju DNK u nju i natjeram je da se replicira u ovom organizmu?

I tako, ako nešto nije na ovoj listi, biće uskoro, OK? Evo još jedne stvari. Ovo je kloniranje komadića DNK.

Samo da dio DNK imamo u biblioteci, ali pretpostavimo da želimo učiniti više od toga da DNK sjedi u bakteriji, pretpostavimo da bih zaista želio učiniti uzeti bakteriju E coli i staviti je u radi za nas. Možda bih htio uzeti plazmid i u taj plazmid umetnuti gen za humani inzulin.

Dakle, uzet ću DNK lokus koji odgovara ljudskom insulinu, klonirat ću ga u svoj plazmid. Možda ću ga izolovati iz svoje biblioteke jer je, da vidimo, sekvenca proteina insulina poznata, tako da bih mogao da je prevedem u nukleotidnu sekvencu. Dakle, mogao bih da ispitam biblioteku.

Dakle, mogao sam pronaći klona koji ima inzulin. Ono što bih želio učiniti je uvjeriti ovu bakteriju ne samo da nosi DNK, već da za mene proizvodi inzulin. Da li bi to bilo korisno? Da, kako su ljudi dobijali inzulin? Leševi, leševi, bilo bi mnogo lakše nabaviti ih iz fermentatora, zar ne, da biste dobili insulin iz fermentora, ako biste samo mogli zamoliti E coli da to učini.

Dakle, ako ga stavimo u E coli, hoće li on napraviti insulin za nas?

Evo ljudskog lokusa, DNK za inzulin. Hoće li proizvoditi insulin? Da vidimo, kako se pravi protein?

Morate početi stvaranjem RNK, zar ne? Morate transkribovati gen. Hoće li E coli transkribovati ovaj gen?

Pa, zašto? Ima promotera, zar ne? Ima promotor insulina. Evo nas. Promotor insulina je ovde.

Znači, E coli će doći do insulinskog promotora i početi stvarati RNK? Ne, pokazalo se da su promotori kod ljudi i promotori kod bakterija dovoljno različiti. Ne funkcionišu među vrstama.

Neće prepoznati ljudskog promotera. Šteta. Ima li ideja?

Da? Tamo zalijepite bakterijski promotor. Dobro, ponašaš se kao dobar dizajner molekularne biologije. Postavimo ovdje promotor bakterija.

Prepoznaće svog promotera. To je odlično. Zatim, stavimo ovdje DNK gena humanog inzulina. A sada, možda ćemo staviti Lac operon, a kad bude imao laktozu, on će početi stvarati RNK od gena humanog inzulina. I počet će to prevoditi.

I, dobijamo insulin. Ima li problema? Pa, hoće li to biti nešto, za početak? Koji je još aspekt gena sisavaca drugačiji od gena bakterija?

Obrada, kakva obrada sa RNK? Spajanje, ooh, inzulinski gen ima introne koje je potrebno izvaditi.

Dakle, ovo će napraviti neku RNK, inzulinsku RNK, i to treba ovako obraditi. Hoće li bakterije nastaviti naše spajanje umjesto nas? Ne rade spajanje. Da? Pa, to je vrlo zanimljivo pitanje jer nismo. Ali, šta predlažete? Vidite, upravo sam uzeo dio ljudske DNK iz ljudskog genoma, koji kodira introne i egzone. No, izgleda da imate rješenje za naš problem, a što bi to bilo? Dakle, umjesto da napravite biblioteku genomske DNK, ono što predlažete je radikalna ideja.

Uzmimo umjesto toga ljudsku RNK. Evo malo ljudske RNK, puno ljudske RNK, velika kolekcija humane RNK. Ono što je bilo na kraju ljudske RNK: poli (A) rep. I ono što razumijem da predlažete je da ako uzmemo ljudske mRNA, čitavu njihovu kolekciju, želite da te mRNK pretvorim natrag u DNK i kloniram ih umjesto da koristim hromozomsku DNK. Kako da vratim RNK u DNK?

Je li to moguće? Šta koristite: reverzna transkriptaza.

Moramo mu dati temelj. Dakle, zapamtite, pet prostih do tri premium, mi bismo hteli da ovde stavimo primer.

Imate li ideju za dobar prajmer? Poly (T), nije li to zgodno?

Jedan od razloga zašto poruke sisavaca imaju poli (A) repove je taj što ih možemo obrnuti transkribirati pomoću poli (T) početnica. Ne, to zapravo nije istina. Dakle, koristimo obrnutu transkriptazu. Ono što možemo učiniti je da ćemo kopirati ovu RNK u lanac DNK. Evo ga.

Zatim, ono što ćemo uraditi, sledeći korak, je da ćemo uzeti DNK, i kopiraćemo nazad u drugi lanac DNK.

A sada, imamo dvolančanu DNK čija se sekvenca poklapa sa već obrađenim mRNA. Izvini? Dakle, sekvence bi odgovarale mRNK. Dakle, umjesto da uzmete ljudsku DNK iz jezgre, mogli biste uzeti RNK, pretvoriti ih natrag u DNK obrnutom transkriptazom i sada napraviti biblioteku koja se sastoji od milijarde umetaka, od kojih svaki ima ono što se naziva cDNA, kopirana DNK, kopirana nazad iz RNK. Velika prednost ovoga je što je ljudska stanica već izvršila spajanje, pa nema više introna. Sada, kada ga ubacite u bakteriju, bakterija to može izraziti. Ako mu date vlastiti bakterijski promotor, on može stvoriti RNK.

I ako ne tražite od bakterija da se spoje, ako joj samo date prethodno spojeni komad DNK koji ne treba spajanje, ona može prevesti tu DNK. Primijetite da smo upotrijebili sve naše trikove. Morali ste znati o obrnutoj transkriptazi, poli (A) repu, strukturi gena, intronima, egzonima, da, pitanje?

Nije. To radite u epruveti. Očistite ljudsku mRNA u epruveti. Uzmete tu mRNA u epruvetu, dodate reverznu transkriptazu, dodate poli (T), pa se ova reakcija RNK na DNK u epruveti vrati nazad.

Odakle dolazi? Virusi koji sami sebe kopiraju za život, zar ne? Dakle, opet, svaka stvar koju koristimo dolazi od nekog živog organizma koji radi ovakve stvari. I, kada vas učim o činjenicama o tome kako se virusi repliciraju ili kako izgleda struktura mRNA ili bilo šta drugo, to je zato što se svaki djelić znanja koje dobijemo o načinu na koji biologija funkcionira pretvara u nevjerojatno moćno oruđe kako se ispostavilo za nas da zapravo moći dalje proučavati biologiju. Dakle, odlično. Dakle, odakle sada dolazi reverzna transkriptaza? Izvorno potječu od virusa koji se sami vraćaju iz RNK u DNK. Kako ćete dobiti reverznu transkriptazu? Katalog, tačno, vrlo dobar. U redu, ovo se konačno zove biblioteka cDNA. I, da ste napravili biblioteku cDNA, mogli biste pregledati biblioteku cDNA kako biste pronašli gen za inzulin.

Je li ovo korisno? To je, na primjer, jedna od posljedica ovoga bila biotehnološka industrija. U redu, pa ako sumnjate u korisnost razumijevanja ovih apstraktnih stvari o E coli i bakterijama i sličnim stvarima, jedna od posljedica bila je Genentech, Biogen i Amgen, i ako samo prošetate Kendall Squareom, unutar milju od ovog mesta videćete da su pred sobom izložene posledice ove sposobnosti, OK? To transformiše Kembridž. Da?

I svijet. Da. Zaista.

Moguće je da je proizvodnja velikih količina inzulina bila loša za bakteriju jer bi bilo toliko proteina da bi se zgrušala i ubila bakteriju. Moguće je da se inzulin, iz različitih razloga, možda neće na odgovarajući način saviti u bakterijskom okruženju.

I to je razlog zašto biotehnološka industrija ima mnogo pametnih ljudi koji rade u njoj jer ste potpuno, 100% u pravu. Možda ćete odlučiti da je umjesto kloniranja u bakteriju bolje klonirati ga u neku ćeliju insekata u kulturi s kojom ljudi, zapravo, vole raditi, ili s nekom drugom ćelijom, ili ćelijom sisavca. I tako, pojednostavljujem rekavši stavi to u coli, ali zapravo bi to moglo testirati šest različitih staničnih linija, šest različitih mogućnosti domaćina.

Možda će morati izvaditi inzulin i ponovo ga presavijati in vitro i slične stvari. Potpuno si u pravu.

Ovo je zapravo nešto što zahteva rad da bi se to uradilo kako treba, baš kao što je za izgradnju aviona potreban rad.

Mogao bih vam reći Bernulijeve principe, ali onda Boeing čini više od toga da samo zapisuje Bernulijeve principe.

U redu, pa naprijed. Sada bih htio prijeći na analizu vašeg klona.

Analizirajući klon, pa pretpostavimo da jesmo, možda je to pozicijskim kloniranjem, možda kloniranjem cDNA, ali na ovaj ili onaj način dobili smo klon koji nas jako zanima.

Možda ima gen za inzulin. Možda ima gen Huntingtonove bolesti. Šta god da je, poželećemo da to proučimo.

I u ovom trenutku vam nisam rekao kako bih uopšte pročitao njegov DNK niz ili analizirao njegovu DNK. Dakle, prvi korak je, naravno, da moram pročistiti plazmid. Ispostavilo se da se to može učiniti.

Postoje jednostavne biokemijske tehnike, kao što sam spomenuo u prethodnom predavanju, koje vam omogućuju da uzgojite mnogo bakterija, razbijete ih, a plazmid je u malom krugu, te je malo čvršće super namotan i namotan ima nešto drugačija fizička svojstva. I možete ih koristiti za pročišćavanje plazmida. Dakle, pripreme za plazmid nije teško napraviti. Možete dobiti prilično čistu kolekciju plazmida.

Pretpostavimo da sam ovo učinio za, oh, ne znam, uzmimo prvi primjer, narančaste mutante. Pretpostavimo da sam pokušao spasiti bakterije koje su bile narandžasti minus, i pretpostavimo da sam otkrio da je 50 različitih plazmida spasilo mog narančastog mutanta jer sam transformirao mnogo plazmida, nasadio sam ga, a 50 kolonija je izraslo.

Jesu li sve iste stvari ili su različite?

Postoji li neki brži način da pogledate ovih 50 plazmida i provjerite jesu li identični ili prilično bliski ili očito različiti? Pa, htio bih uzeti neki način da uzmem DNK iz plazmida i da ga lako analiziram. Možda bih htio vidjeti, primjerice, koliko je velik umetak? Da, to bi bio jedan način, da imaju umetke različite veličine pa ne bi mogli biti ista stvar.

Pa, možda bih mogao učiniti kako da ovo kloniram? Koristio sam EcoRI stranice kojih se sećam. Dakle, ovdje imam EcoRI web stranice. Pretpostavimo da sam trebao uzeti ovu DNK, a sada sam trebao izrezati DNK iz plazmida sa EcoRI.

Onda bih dobio dva odvojena molekula.

Uzeo bih vektor i umetak. Kako sam mogao vidjeti koliko su veliki? Gelovi, elektroforeza u gelu je način za to. Dakle, uzimam gel. Gel je ploča želatine, žele, OK, i obično je položen ravno, ali ja ću to uraditi okomito ovdje. Ovdje ubacim malo svoje DNK, cijelu ovu mješavinu. Uzimam plazmid. Presekao sam ga. Stavio sam ga ovde. DNK pozitivan ili negativan naboj? Negativno. Dakle, gdje da stavim pozitivno povlačenje? Na dnu, odlično urađeno.

To se često ne radi, a na štetu eksperimenta.

Ako ovdje stavite pozitivan utjecaj, to ide u pogrešnom smjeru i to moraju učiniti barem jednom. Dakle, što će se dogoditi ako se fragmenti DNK kreću, a manji se fragmenti kreću brže od velikih, zar ne? Ako je nešto malo, brzo će se kretati. Ako je nešto veliko, kreće se polako: malo, veliko.

Manji se brže kreće jer se bolje kreće kroz male pore u gelu. Pretpostavimo da sam ovo trebao učiniti za gomilu plazmida, a ono što sam vidio je ovo.

Prva narudžba, što pretpostavljate? Izvini? Gornji put je vjerovatno plazmidni vektor. Ovo je vjerovatno vektor, a šta ja znam o umetcima? Najmanje dva umetka, najmanje dva različita umetka. Sada, ako sam želeo da budem siguran da je to vektor, možda ono što bih mogao da uradim je da uzmem još jedan red i pokrenem poznatu količinu vektora, uzmem sam vektor i mogu da proverim da li sam vektor prolazi ovde. A možda bih mogao uzeti neke druge poznate molekule. To bi se zvali standardi molekularne težine. Dakle, ako pokrenem neka znanja u jednoj od traka gela, mogu čak izmjeriti i reći, ah-ha, umetak je negdje između veličine ove i veličine one. I tako, dobijem malo ravnalo koje mogu staviti na gel. Dakle, u stvari, to je prvo što biste učinili da na taj način probavite svog klona.

Dakle, znači li činjenica da ti momci imaju potpuno istu, očigledno, veličinu na gelu, znači da su potpuno isti dio DNK? Ne, jer čak ni ne možete reći da je potpuno isto.

Postoji granica koliko precizno to možete izmjeriti.

Dakle, što ste drugo mogli učiniti? Možete probati neki drugi restrikcijski enzim. Ispostavilo se da, budući da u katalogu ima toliko restrikcijskih enzima, ako uzmem dio DNK, možda taj Eco fragment, mogao bih ga pokušati izrezati s HinDIII.

A kad ga presiječem s HinDIII, dobit ću tri različite dužine. Mogao bih da pokušam da ga isečem sa, oh, ne znam, izabrati drugi enzim, BamHI. Kada ga isečem sa BamHI, nabaviću neke druge dužine. I kako dobiti ove dužine dodavanjem ovih, tako što ćete ih nanijeti na gel i pogledati njihove veličine.

Šta ako sam u epruvetu dodao i HinDIII i BamHI?

Rezao bih na oba sajta. Dakle, presekao bih ovde, ovde, ovde, ovde, ovde. Dakle, ovo je izrezano sa HinDIII, ovdje rezano sa BamHI, ovdje izrezano sa oba i mogao bih izmjeriti ove dužine. Dakle, pretpostavimo da sam vam ovo dao kao kompjuterski problem, imam niz i to je nepoznati niz, pa sam ga prerezao na dva mjesta i dobio sam ove dužine, X1, X2, X3. I onda uzmem taj isti niz i presečem ga na drugim pozicijama, Y1, Y2 i Y3 su dužine koje rezultiraju. I onda pretpostavimo da ga sada isečem na obe lokacije, i izmerim ga, i dobijem Z1, Z2, Z3, Z4, Z5. Ako bih vam dao sve te brojeve, možete li shvatiti gdje se nalaze te lokacije? Vjerovatno. Ispostavilo se da je to razumno izvodljiv kompjuterski problem, iako na mjestima može postati malo težak. Mogli biste probati i treći enzim i četvrti enzim, i to je slatka vježba da napišete sebi mali dio koda koji će otkriti gdje se stranice nalaze na osnovu dužine. Razlog zašto povremeno postaje smiješno šta je ako su Z3 i Z4 potpuno iste dužine i trče jedan preko drugog u gelu, a postoje i posebni slučajevi.

Ali možete nekako rekonstruirati gdje ta ograničenja moraju biti samo tako što ćete napisati dobar dio koda koji će spojiti te dijelove. To se naziva preslikavanje ograničenja i jako je zabavno. Svi vole ovo raditi jednom.

Ali, to je samo ograničena količina informacija, zar ne, jer dobijate gdje se nalaze stranice, i pretpostavljam da ako sam vam dao deset klonova i svi su imali potpuno iste mape ograničenja, potpuno iste pozicije ovih stranica sa ograničenjima, bio sam prilično siguran da su isti klon.

Ali još uvijek ne biste znali mnogo o klonu osim što je imao dvije HinDIII stranice i dvije BamHI stranice, a evo i gdje su bile.

Šta zaista želite znati o ovom klonu? To je DNK sekvenca, zar ne? Nemojmo se zadovoljavati ničim manjim od tačne nukleotidne sekvence klona. Dakle, to je zaista posljednja ključna tema sekvenciranje DNK.

Kako ćete sekvencirati DNK? Pa, pretpostavimo da vam dam neki dvostruki lanac DNK, pet osnovnih prema tri početne, pet primarnih, tri primarne, dvolančane DNK.

Daj da ga zagrijem. Šta se dešava kada zagrijem DNK?

Otapa vodonične veze, nekovalentne vodonične veze se prekidaju i ja sam razdvojio svoja dva lanca. Ono što bih želio učiniti je da želim početi čitati ovaj DNK niz.

Tako da ću od sebe napraviti temeljni premaz. Bože, evo bukvara.

Pitat ćete me, kako sam uopće znao koji prajmer koristiti ako ne znam DNK sekvencu? Kako mogu napraviti prajmer?

Zadrži to pitanje. Pobrini se da se sjetim vratiti i odgovoriti na to, u redu? Ali za sada, odobri mi da ovdje imam bukvar.

Ono što bih želio je dodati DNK polimerazu. Dakle, dodajmo malo DNK polimeraze. I, želio bih da dodam nukleotidne trifosfate, dNTP, dATP, dCTP, dGTP, dTTP, i ako dodam DNK polimerazu i dodam svoje nukleotide, šta će nam Arthur Kornberg reći da će se dogoditi? Počeće polimerizacija, zar ne? I tu će stati. Dakle, polimeraza poznaje baze, zar ne? On zna koju bazu staviti jer je polimeraza vrlo pametna.

Dakle, baze se pravilno postavljaju. Jedini problem je, kako da nateramo polimerazu da nam kaže šta je upravo uradila?

Evo jednog slatkog trika. Ovo je, inače, simpatičan trik koji je dobio Nobelovu nagradu. Dakle, pretpostavimo da je moj prajmer ovakav: pet osnovnih, T, A, A, T, T, C, T, i predložak ovdje, A, T, T, A, A, G, A, sada idemo dalje , A, T, G, C, C, A, A, T, G, G, A, T, T, A, pet prostih. Dakle, tu je moj primer.

Evo mog šablona. Ja ću početi dodavati. Pa, dodajmo našu polimerazu. Hajde da dodamo naše dNTP, polimerazu, dATP, dCTP, dTTP, dGTP, a onda želim da dodam poseban ekstra dobar stari sastojak u ovo.

Poseban dodatni sastojak koji želim dodati je neispravan T, neispravan dTTP. Šta mislim pod defektom? Mislim kemijski modificiran na takav način da se ne može produžiti, da se ne može proširiti pored njega. Pa sad, pratimo moju reakciju.

Počeću sa, samo ću ih zapisati ovde, T, A, A, T, T, C, T. Koju ću sledeću bazu staviti?

T, OK? Je li to neispravan T ili dobar T? Ne znam.

To može biti. Možda je neispravan T, na koji ću staviti malu zvjezdicu, OK? Ako je tako, što će se dogoditi s mojom polimerazom?

Prestaje. Ne može dalje. Ne može dalje jer je T neispravan. Ali šta ako to nije neispravan T?

Šta ako je to bio dobar T? Šta se onda dešava? Polimeraza će se staviti, samo nastavite momci. A, C, G, G, i šta sad stavlja? T, zar ne? Je li to neispravan T? Možda. Ne znamo.

Ako je neispravan T, tu se zaustavlja. Inače, polimeraza ide ovdje, a sljedeći prostor je šta?

T, i je li to neispravan T? Možda.

I, ako nije neispravan T, tada se nastavlja polimeraza, stavlja A, stavlja G, C, C, a zatim T.

A možda je to neispravno. U redu, koja od ovih mogućnosti radi polimerazu kada je ubacim?

Pa, svi. Tamo ima puno molekula.

Neki od molekula slučajno ugrade neispravan T i tu se zaustave. Ponekad se stavi dobar T i molekuli se zaustave ovdje. Ponekad se ovdje zaustave, i ako počnem s velikom kolekcijom prajmera u velikom dijelu svog šablonskog DNK, dobiću cijelu ovu kolekciju različitih molekula različitih dužina. Koje dužine mogu dobiti?

Dužine tačno odgovaraju pozicijama Ts.

Dobijam niz molekula čije se dužine savršeno podudaraju s položajima Ts. Pa, prvo, kako da izmjerim njihove dužine? Pokreni gel, bingo, pokreni gel.

Dakle, kada bih mogao pokrenuti gel koji bi mogao odvojiti nukleotide na osnovu dužine dva jedan do drugog, još jedan gore, vidio bih mali molekul, dužine jedan, dva, tri, četiri, pet, tri, šest, osam, video bih jednu dužine osam. Video bih jedan dužine, šta je sledeće, 13, osam, devet, deset, 13, 14, dakle osam, devet, deset, 11, 12, 13, 14, 15, šta je to, 13, 14, 15 , 16, 17, 18. OK, to bi bili položaji na kojima bih vidio ovaj T. Dakle, trebao bih imati posebnu vrstu gela koji je toliko precizan da može odvojiti pojedinačne nukleotide, zar ne, tako da su dužine , ali to se može učiniti.

Postoji akrilamid, polimer koji će to učiniti.

To će mi reći tačne dužine T-ova. Šta drugo da radim?

Pa, učinimo to očigledno iz drugih baza.

Pokušajmo neispravni A, neispravan C, neispravan G.

Da vidimo, ako sam dobro shvatio, što ćemo pokušati, na kraju bi trebalo izgledati tako. A ako ne, dobivate sliku da bi se ovo trebalo podudarati s tim koji stupci imaju koju dužinu.

U redu, mislim da sam dobro shvatio. To mi govori o dužini molekula. Dakle, mogao sam da čitam u nizu.

Redoslijed tog molekula bi trebao biti, počevši od tamo, slijed onoga što sam dodao, trebao bi biti nešto poput T, A, C, G, G, T, T, A, C, C, T, da, upalilo je.

To je tačno. Bingo. Sada mogu pročitati niz.

Fred Sanger, briljantan naučnik, smislio je ovu metodu samo iskorištavanja vlastite polimeraze E coli ili polimeraza drugog organizma.

Dakle, kopiranje i sva hemija koja je morala biti urađena je smišljanje neispravnog nukleotida koji se nije mogao produžiti.

Očigledno bi se moglo umetnuti. Ne može se produžiti. Dakle, jedno pitanje je, šta je defektni nukleotid? Pa, setićete se da naš nukleotid u lancu šećer-fosfata sedi ovako. Da vidimo, baza koja visi s jednog primarnog ugljika. Ovo je jedan primarni ugljenik, dva osnovna ugljenika, tri osnovna ugljenika, četiri osnovna ugljenika, pet osnovnih ugljenika. Šta znamo u DNK na dva osnovna ugljika?

Obično bi u ribozi ovdje bio hidroksil, zar ne? Ali u dezoksiribozi postoji samo vodonik.

Dakle, ako je ovo deoksiriboza, tako da dNTP zaista znači dvije glavne dezoksiriboze, gdje da prikačim svoju sljedeću bazu u nizu šećernih fosfata? Tri glavna kraja i na šta ih pričvršćujem: OH.

Šta mislite da bi se dogodilo da tamo nema OH?

Zaglavili ste. Sve što trebate učiniti je skinuti taj hidroksil.

Nema hidroksilnu grupu. Ako ste napravili nukleotide koji nemaju tu hidroksilnu grupu, oni se ne mogu produžiti.

Dakle, umjesto da su samo deoksi na dvije glavne pozicije, oni su dideoksi, deoksi na dvije pozicije.

To su dva prosta, tri prosta, dideoksinukleotida.

To je to. E sad, ako ste trebali nabaviti dva osnovna tri osnovna dideoksinukleotida, oni su naravno u katalogu, zar ne, jer je Fred Sanger morao sam da ih napravi i sve to, ali sada ih možete kupiti. I tako, možete napraviti sekvencu.

Nekoliko drugih detalja ovdje, momci.

Kako vidimo DNK i gel? Jedna mogućnost bi bila mrlja. Postoje neke matrice poput etidij bromida, pa je za izradu restrikcijskog mapiranja upotreba boje koja se lijepi za DNK poput etidij bromida prilično dobra. Zatim ga stavite pod fluorescentno svjetlo i pogledate. Za sekvenciranje, količina DNK je toliko mala da je teško vidjeti bojom golim okom, što je ono što radite sa mapom ograničenja. Pa, izvini?

Dakle, prvo što su ljudi učinili bilo je radioaktivno. Oni su uradili to što su uzeli prajmer, učinili ga radioaktivnim, a vi ste cijelu ovu reakciju sekvenciranja izveli s radioaktivnim prajmerom.

Zatim, kada pokrenete gel, uzmete svoj gel i izlažete ga nekoliko sati, možda osam sati, komad rendgenskog filma, razvijete rendgenski film i vidjet ćete tu sliku. Dakle, jedno rješenje koje biste mogli zamisliti je korištenje radioaktivnih nukleotida. Dakle, dobili smo neispravan nukleotid.

Sada moramo vizualizirati naš DNK. Vizualiziramo niz.

Jedna mogućnost: radioaktivna. Druga mogućnost, neko je već pomenuo, fluorescentna boja.

Evo, ovdje bi se mogla staviti fluorescentna boja, koju ne možete čitati okom, ali laseri jako dobro čitaju.

Dakle, ovdje možete pokrenuti cijeli gel i laseri ga skenirati.

Ali, zapravo možete bolje od toga. Pretpostavimo da sam stavio svoju fluorescentnu boju na svoje dideoksinukleotide.

Pretpostavimo da sam to stavio na svoje dideoksinukleotide, pa čak i da imam na raspolaganju dovoljno hemije da mogu staviti različitu boju fluorescentne boje na svaki od svojih nukleotida. Zatim, kad god se dideoksi stavi da prekine lanac, on nosi sa sobom svoju boju.

Zar to ne bi bilo cool? I to je urađeno. Ne samo da sada možete kupiti dideoksinukleotide, već možete kupiti i četiri različita dideoksinukleotida od kojih svaki ima svoju boju.

Dakle, postoje di-dideoksiji pretpostavljam, oprostite, ali to je drugačije, zar ne? To su boje-dideoksiji. Dakle, mogao bi to da uradiš.

I onda ono što dobijete je da u ovoj koloni dobijete ovu boju.

I u ovoj koloni, dobili biste ovu boju. I u ovoj koloni ćete dobiti ovu boju itd. Ne brinem se o tome gdje su oni ovdje. I sve bi bile različitih boja i bilo bi jako lijepo. Znaš šta? Zašto više moramo da vozimo odvojene trake? Ako imamo laser, možemo reći laserskom skeniranju da mu kaže drugačije. Zalijepite ga na jedan način. Zapravo, ono što je učinjeno je da ga zabijete u kapilarnu cijev, ubacite sve četiri istovremeno u isto vrijeme, a kako ti fragmenti prolaze, svaki ima svoju boju. I sve što nam treba je laserski skener koji može sjediti upravo ovdje. Evo mog laserskog skenera. I laserski skener, pozitivan ovdje, negativan ovdje, dok DNK prolazi kroz ovaj polimer, laserski skener očitava koje su boje upravo prošle.

I ide A boja, C boja, T boja, G boja. To je to. Dakle, sada postoje mašine koje imaju 96 različitih kapilara.

One se nazivaju kapilarne cijevi. I možete ih imati 96 s laserskim skeniranjem po cijelom, a sada se u svakoj koloni ispostavlja da možete pročitati gotovo 1.000 slova, 1.000 baza po stupcu po kapilari puta oko 100 kapilara.

Ili drugim riječima, možete pročitati oko 10^5 baza podataka.

Za oko dva sata možete pročitati 10^5 baza podataka.

Naravno, to možete raditi deset puta dnevno. Dakle, zapravo možete pročitati 10^6 ili oko milion baza informacija po mašini. A ovdje na MIT -u imamo 100 ovih mašina. Dakle, zapravo možemo pročitati pomalo sramežljivih 100 miliona slova DNK sekvence dnevno, što mislim mnogo.

Ovdje na MIT -u čitamo oko 40 milijardi pisama godišnje, i ovako to radimo. Koliko košta mašina?

Navedite spisak ili želite dogovor? Kotaju 300 dolara, 00, ali ako kupujete na veliko, mogu bolje. [SMIJEH] Usput, kupujemo ga na veliko. Dakle, kako ćemo sada doći do našeg prajmera? To je jedino što nam je nedostajalo jeste odakle je došao naš primer? Zadnji mali detalj: evo mog vektora, zapamtite, i želim rasporediti ovaj umetak.

Kako ću dobiti temeljni premaz u umetku? Ne znam koji je njegov redosled. Kako da uopšte započnem ovo? Izvini? Pa, ali to mi neće reći koji je redoslijed koji moram, mislim, pokušao sam pokušati nabaviti temeljni premaz koji odgovara umetku.

I ne znam šta je umetak. Dakle, kako ću nabaviti prajmer?

Oh, znam vektor. Vektor je dobro poznat.

Njegov niz je u katalogu. Dopustite mi da umjesto toga samo upotrijebim prajmer koji se nalazi u vektoru, i za početak ću upariti s poznatim nizom, a zatim ću sekvencirati u svoju nepoznatu teritoriju. Dakle, ovako dobijate početni prajmer ako uredite da vaš početni prajmer leži u poznatom vektorskom nizu. U redu, sada možete sekvencirati DNK. Moram da kažem da sam predavao ovaj kurs nešto više od decenije, i kad sam u stanju da kažem, sada možemo rutinski da sekvenciramo oko milion slova po mašini, i 100 miliona slova dnevno, i ovakve stvari nije rutinski bio slučaj. Kada smo počeli da predajemo ovaj kurs, ja sam opisivao šta mi radimo


Diskusija

Ekspresija rastvorljivog rekombinantnog proteina i dalje je usko grlo za projekte funkcionalne i strukturne genomike koji proučavaju ljudske proteine. Ovdje pokazujemo metodu za generiranje i karakteriziranje velikog niza ekspresijskih klonova za ljudske proteine ​​iz biblioteke cDNA, dajući unaprijed odabir klonova za ekspresiju velikih razmjera. Uparivanje sekvenci klonova sa Ensembl bazom podataka, pokazalo se da su ekspresijski klonovi sa rastvorljivim produktima pronađeni za 1.509 humanih proteina koji odgovaraju 1.105 različitih gena. Da bismo našim pristupom pokrili veći skup proteina, mogle bi se koristiti dodatne biblioteke iz različitih tkiva i razvojnih faza.

Utvrđeno je da su 36% ekspresijskih klonova potpuni ORF klonovi koji eksprimiraju potpune ljudske proteine, dok preostali klonovi izražavaju karboksi-terminalne fragmente. Treba napomenuti da, budući da se baza podataka Ensembl generira automatski i da su pozicije početnog kodona još uvijek nepoznate za mnoge ljudske transkripte, ovaj broj je netočan i vjerojatno će biti veći. Buduća izdanja Ensembla će imati koristi od tekućih napora da se generiraju i anotiraju ljudske cDNK sekvence pune dužine [21], a informacije o početnim pozicijama ORF-a trebale bi se poboljšati u skladu s tim.

Postoji nekoliko razloga za prisustvo klonova koji eksprimiraju karboksi-terminalne fragmente. Određeni dio nepotpunih umetaka uobičajena je karakteristika biblioteka cDNA konstruiranih ovdje korištenom tehnikom kloniranja. Nadalje, klonovi sa punim ORF koji sadrže dijelove 5'-netranslatiranog regiona (UTR) nisu detektovani na našem ekranu ekspresije ako UTR sadrži stop kodone. Činjenica da se manji proteini ili fragmenti često izražavaju bolje od vrlo velikih proteina E. coli mogao bi biti još jedan razlog zašto su dobiveni mnogi klonovi koji izražavaju karboksi-terminalne fragmente.

Full-ORF klonovi općenito su potrebni za određivanje proteinskih struktura. Međutim, fragmenti karboksi terminala mogu biti zanimljivi za druge primjene, kao što je strukturna analiza domena NMR spektroskopijom.

Kao primjer primjene okarakterizirane biblioteke klonova prikazujemo izbor klonova za analizu strukture. Skrining velike produktivnosti za klonove ekspresije trajao je oko godinu dana, dok je rad na 163 odabrana proteina još uvijek u toku, a dodatni proteini se pročišćavaju. Od 17 proteinskih pripravaka riješene su tri nove proteinske strukture.

U zaključku, sistematski pristup skriningu za E. coli Ovdje su opisani ekspresijski klonovi humanih proteina. Koristeći ovaj pristup, stvoren je javni resurs od 2.746 klonova koji omogućava projektima funkcionalne genomike da odaberu klonove i izraze ljudske proteine ​​od interesa.


Molekularno kloniranje, ekspresija, pročišćavanje i funkcionalna karakterizacija dammarenediol sintaze iz Panax ginseng

Cilj ove studije je klonirati i karakterizirati ekspresiju gena dammarendiol sintaze, a zatim odrediti odnos između ekspresije gena dammarendiol sintaze koji je uključen u put biosinteze ginsenozida i sadržaja ginsenozida. Biblioteka cDNA faga je napravljena od petogodišnjeg korijena ginsenga. Biblioteka cDNA je pregledana pomoću gena za dammarendiol sintazu koristeći njegove specifične prajmere. Dalje je kloniran i izražen u vektoru pET-30a. Rekombinantni plazmid pET-30a-DS je eksprimiran u Rosetti E. coli. Rekombinantni DS protein pročišćen je afinitetnom hromatografijom. Proizvodnja dammarendiola je detektovana tečnom hromatografijom-masenom spektrometrijom (LC-MS). Rezultati su pokazali da je gen dammarendiol sintaze kloniran iz cDNK biblioteke i eksprimiran u Rosetti E. coli a SDS-PAGE analiza je pokazala prisustvo prečišćenog DS proteina. LS-MS je pokazao aktivnost DS proteina, kako se sadržaj proteina povećava, povećava se dammarendiol. Naši rezultati ukazuju da bi rekombinantni protein dammarenediol sintaze mogao povećati proizvodnju dammarenediola, a ekspresija DS -a imala je vitalnu ulogu u biosintezi ginsenozida u P. ginseng.

1. Uvod

Medicinski Panax ginseng C. A. Meyer pripada Panax rod iz porodice Araliaceae. Kao tradicionalna ljekovita biljka, koristi se hiljadama godina. Moderne studije medicinske hemije i farmakologije potvrdile su da različiti sastavi ginsenga imaju ulogu u jačanju imuniteta, neuralnoj zaštiti, antiaging, antidepresivima, antitumorskim i drugim aspektima [1–6], a također imaju dobre izglede za primjenu sa značajnom ekonomskom vrijednošću.

Unatoč tim izgledima, poteškoće u isporuci ginsenozida u čistom obliku u većim količinama spriječile su njihovu upotrebu kao kliničke lijekove. Kvaliteta i rast ginsenga bili su ozbiljno ograničeni zbog niske stope rasta, zbog utjecaja klime, geografije i uvjeta uzgoja [7, 8]. Izolacija i pročišćavanje svakog ginsenozida uključuje duže i komplikovane procedure. Alternativno, ekspresija gena za biosintetske enzime u heterolognim organizmima domaćinima, nadamo se u brzo rastućim mikrobima, kao što je Escherichia coli, može dovesti do proizvodnje ginsenozida u većim količinama. Očekivalo se da će genetski inženjering postati najperspektivniji način za proizvodnju sekundarnih medicinskih metabolita niskog sadržaja, a visoko se očekuje kloniranje relevantnih gena biosinteze ginsenozida.

Ginsenosid pripada triterpenoidu, koji se prema osnovnoj strukturi aglikona može klasificirati u dammaran tip i oleanane tip [9, 10], a većina ginsenozida je bila u tipu dammarana. Trenutno se proces biosinteze može podijeliti u 3 procesa: (1) sinteza 3 izopren pirofosfata i dva metil alil pirofosfata (2) sinteza važnih međuprekursora 2,3-skvalen oksida i (3) ciklizacija 2,3 oksidacija skvalena [10, 11]. Ciklizacija oksidoskvalena je biosintetičko grananje koje usmjerava ne samo na fitosterole i triterpene, već i na ginsenozide tipa dammarana i oleanana. U prethodnoj studiji, prvi korak u sintezi ginsenozida je ciklizacija 2,3-oksidoskvalena u dammarendiol II, kataliziran DS-om grupe oksidoskvalen ciklaze [12]. To znači da je oksidacija skvalena najprije sintetizirana u dammarendiol pod djelovanjem dammarendiol sintaze (DS), a zatim je generirana u različite vrste dammaran saponina kroz seriju reakcija hidroksilacije i glikozilacije [10].

Posljednjih godina mnoga istraživanja usredotočena su na razvoj učinkovitih bioloških sistema za proizvodnju ginsenozida primjenom rekombinantne tehnologije. Nedavno je kloniran i funkcionalno okarakteriziran veliki broj pentacikličkih triterpenskih sintaza iz različitih biljnih vrsta [13–15]. Međutim, ekspresija gena za biosintetske enzime u heterolognim organizmima domaćinima, kao što je npr Escherichia coli, nije dobijeno. I da li je postojala određena korelacija između aktivnosti DS i sadržaja saponina in vitro još uvijek je trebala eksperimentalna provjera. U ovoj smo studiji pokušali klonirati i eksprimirati dammarendiol sintazu u prokariotskom sistemu, prvom angažiranom enzimu za biosintezu izvornog sapogenina ginsenozida dammaran tipa. Pokazano je da je endogeni protein dammarenediol sintaze dobiven prokariotskom ekspresijom i analizirana je povezanost aktivnosti DS i akumulacije dammarendiola pomoću LC-MS.

2. Materijali i metode

2.1. Eksperimentalni materijal

Ginseng od jedne, tri, četiri i pet godina uzet je iz Ljekovitog botaničkog vrta, Poljoprivrednog sveučilišta Jilin, a vlaknasti korijeni tkiva korijena ginsenga korišteni su u eksperimentalnim studijama.

2.2. Reagensi

Trizol reagens je kupljen od Invitrogena, Smart TM cDNA bibliotečki komplet za izgradnju nabavljen je od kompanije Clontech, USA, Gigapack Komplet ekstrakta zlatnog pakovanja kupljen je od kompanije Stratagene, Reverzna transkriptaza, Ex Taq DNK polimeraza, pMD18-T vektor, DL-2000 Marker kupljeni su od kompanije TaKaRa, Real Master Mix kupljen je od kompanije Changchun, komplet za prečišćavanje proteina Ni-agaroze je kupljen od Beijing Kangwei Century Company, skvalen je kupljen od Changchun DingGuo Biotechnology Co., Ltd., Dammarenediol Standard je kupljen od YunNan XiLi Biotechnology Co., Ltd., enzim skvalen epoksidaza je pripremljen u laboratoriji, i E. coli Soj Rosetta i pET-30a Expression Vector su iz naše laboratorije.

2.3. Konstrukcija i detekcija cDNA fažne biblioteke korijena ginsenga

Ukupna RNA iz različitih tkiva korijena ginsenga ekstrahirana je upotrebom Trizola. cDNA je sintetizirana korištenjem ukupne RNA kao predloška, ​​s AMV reverznom transkriptazom i oligo-dT početnim slojem. cjelovita cDNA biblioteka petogodišnjaka P. ginseng je konstruiran korištenjem SmartTM cDNA Library Construction kita. selekcija plaka, detekcija veličine umetnutog fragmenta i proračun brzine reorganizacije obavljen je PCR-om (Sense: CCATTGTGTTGGTACC CGG, Antisense: ATACGACTCACTATAG GGCGAATT).

2.4. DS kloniranje gena i analiza sekvence

Konzervativni početnici gena DS (Sense: ATTAAGAATGTGGAAGCAGAAGG, Antisense: CTTAAATTTTGGCTGCTGGTG) dizajnirani su na osnovu srodnih sekvenci GenBank -a i korišteni su za filtriranje DS gena iz biblioteke cDNA. Ciljani PCR fragment je pronađen nakon elektroforeze u agaroznom gelu i kloniran u pMD18-T vektor. Da bi se identifikovao ispravan rekombinantni plazmid, on je sekvenciran (Shanghai Sheng Gong biološki inženjering, Šangaj), a DNK sekvence gena DS dostavljene su GenBank -u (pristupni broj: JN596111). Naziv ispravnog konstrukta je pMD-18T-DS.

2.5. Konstrukcija i identifikacija pET-30a-DS

pET-30a i DS genski fragmenti iz pMD-18T-DS plazmida su digestirani od strane Ncoja i NeI, i ligacijom sa T4DNA ligazom na 16 ° C, zatim transformisana u Rosettu E. coli kompetentne ćelije i kultivisane preko noći na 37°C.Pozitivni klonovi su odabrani dvostrukom digestijom i da bi se identifikovao ispravan umetak, poslat je na sekvencioniranje. Pozitivni klon nazvan je pET-30a-DS.

2.6. Inducirana ekspresija rekombinantnog i pročišćavanja fuzijskog proteina

E. coli ćelije koje nose ekspresijski konstrukt uzgajane su u 10 mL LB bujona koji sadrži 30 μg/mL kanamicina plus 34 μg/mL hloramfenikola za Rosettu na 37°C preko noći uz stalno mućkanje. Rekombinantne bakterije su inokulirane u LB mediju i kultivirane na 37°C do OD600 od 0,4 do 0,6, s različitom koncentracijom IPTG (konačne koncentracije od 0,1, 0,2, 0,6, 0,8 i 1,0 mmol/L) da bi izazvale ekspresiju i inducirane za 4 h pod utvrđenom optimalnom koncentracijom IPTG. Bakterijski lizat prikupljen je 4 sata kasnije i detektovan SDS-PAGE elektroforezom, s neinduciranom rekombinantnom Rosettom kao kontrolom.

Preko noći kulture bakterijskih stanica razrijeđene su 50 puta u 1 L LB juhe, dopunjene odgovarajućim antibioticima, kultivirane na gore opisani način dok nije postignut OD600 od 0,4-0,6, a zatim su inducirane da eksprimiraju rekombinantne proteine ​​4 sata dodavanjem izopropila β-D-galaktopiranozid (IPTG) do konačne koncentracije od 0,6 mM. Ćelije su ultrazvučno obrađivane 2 minute, a talog je otopljen otopinom rastvorljivog vezivnog pufera (20 mmol/L Tris-HCl, 10 mmol/L, imidazol, 0.5 mol/L NaCl). Talog dobijen iz 12000 g centrifugiranja tokom 20 minuta je inkluzijsko tijelo. Inkluzijsko tijelo otopljeno je 1 sat u ledenoj vodenoj kupelji i centrifugirano na 10000 g 20 minuta, a supernatant je filtriran sa 0,45 μm membranska filtracija. Nakon uravnotežene afinitetne hromatografije na Ni-agarozi, rekombinantni proteini označeni Hisom su otopljeni pomoću otapala rastvorljivog veznog pufera i pročišćeni hromatografijom na agarozi Ni-NTA, na kraju su vrhovi elucije prikupljeni prema 280 nm ultraljubičastoj apsorpcionoj vrijednosti.

2.7. Detekcija aktivnosti rekombinantnog proteina

U ovoj studiji, SEQ enzim je eksprimiran i pročišćen korištenjem prokariotskog ekspresionog vektora, koji je prethodno završen. Proces katalitičke reakcije DS enzima uključuje dvije faze. Prvo je skvalen odabran kao podloga. Pod istom količinom supstrata, skvalen je kataliziran istom količinom SQE enzima kako bi se proizveo međuproizvod 2,3-oksidoskvalena u različitim reakcionim sistemima. Nakon toga, 2,3-oksidoskvalen je dalje kataliziran različitim količinama DS enzima kako bi se proizveo dammarandiol. Nakon završetka enzimske reakcije, enzim je inaktiviran zagrijavanjem na 100°C. Na osnovu karakteristika visoke rastvorljivosti sapogenina damarandiola u etanolu i niske rastvorljivosti u acetonu, nakon ekstrakcije etanolom, aceton je dodat u etanol da bi se izdvojio damarandiol, koji je potom detektovan LC-MS tehnikom.

Eksperiment se može podijeliti u pet DS enzimskih reakcijskih sistema. Supstrat skvalen (20 L) je dodan u centrifugalnu epruvetu u kojoj se nalazi Tris-HCl pufer (pH 6,0), a zatim dodat rastvor DS enzima (0,65 g/mL) 5 μL, 10 μL, 15 μL, 20 μL, 25 μL redom, i dodat rastvor SQE enzima (0,35 g/mL) 20 μL u svakoj od centrifugalnih cijevi i reagirali su na 37 ° C 1 sat, a zatim je temperatura podignuta na 100 ° C. Nakon 10 minuta, enzimska reakcija je zaustavljena. Proizvodnja dammarnediola je otkrivena tečnom hromatografijom-tandem masenom spektrometrijom.

Stanje hromatografske kolone: ​​Zorbax Extend-C18 kolona, ​​5 μm veličina čestica,

mmL · D, pokretna faza kompanije American Agilent: voda, acetonitril, protok mravlje kiseline: 0,8 mL/min temperatura kolone: ​​veličina uzorka na sobnoj temperaturi: 25 μL. Maseni spektrometrijski uvjeti: napon ubrizgavanja iona jona izvora elektrosprej (ESI): napon ubrizgavanja iona: 5500 V temperatura: 550 ° C izvorni plin 1 (GS1, N2) tlak: 70 psi plina 2 (GS2, N2) tlak: 60 psi praćenje pozitivnog iona : način skeniranja za praćenje pozitivnih iona DP napon: 70 V EP napon: 10 V CXP: 4,0 V energija raspadanja: 40 V. Jonski par za kvalitativnu analizu je 391/93,1, ionski par za kvantitativnu analizu je 391/149. Proizvodi različitih enzimskih reakcionih sistema se ubrizgavaju u injekcionu rupu kako bi se uočile promjene površine vrha elucije. Standardna koncentracija dammarenediola bila je 1 mg/L, a količina proizvodnje dammarenediola izračunata je usporedbom s omjerom površine vrha standarda.

3. Rezultati i analiza

3.1. Sinteza dvolančane cDNK i detekcija kvaliteta biblioteke faga

Nakon detekcije ultraljubičaste spektrofotometrije, A260/A280 ukupne RNK je 1,96. Rezultati elektroforeze pokazali su da se dvolančana cDNA nalazi između 0,3 i 2,5 kb, predstavljajući izduženu traku sličnu vodopadu, koja se dobro slaže s distribucijom DNK biljnog tkiva. Prema broju PCR identifikacija bakterijskih kolonija i bakterijskih tekućina, stopa rekombinacije bila je 95,17%. Kapacitet originalne biblioteke je

3.2. DS kloniranje gena i analiza sekvence

Nakon elektroforeze, produkt PC amplifikacije DS gena dobio je specifičnu traku od oko 2310 bp, što se dobro slaže s očekivanim rezultatima. pMD-18T-DS plazmid je digestiran pomoću Xbaja i PstI i veličina umetka od 2310 bp, dobijena je veličina koja odgovara ciljnoj traci. BLAST analiza je otkrila da DS cDNA nosi fragment potpuno otvorenog okvira za čitanje (ORF) od 2310 bp. Utvrđeno je da su aminokiseline DS (769 aminokiselina sa predviđenom molekulskom masom od 84,6 kDa) 56, 50 i 48% identične onima u β-amirin sintaza, cikloartenol sintaza i lanosterol sintaza u P. ginseng.

3.3. Identifikacija vektora rekombinantne ekspresije i inducirane ekspresije rekombinantne

Specifični pojas veličine oko 2310 bp, u skladu s očekivanjima, dobijen je primjenom Ncoja i NeJa dvostruko probavljam pET-30a-DS. Rezultati su otkrili da je DS gen umetnut u pET-30a vektor, te da je konstruisan rekombinantni plazmid pET-30a-DS.

Rekombinantni plazmid pET-30a-DS je transformisan u Rosettu E. coli da se inducira za ekspresiju gena. Eksprimirani proizvod je identificiran pomoću SDS-PAGE, a pronađene su specifične proteinske trake na oko 89 kDa, koje odgovaraju veličini molekularne mase predviđenog rekombinantnog proteina označenog s Hisom (slika 1). Kad je konačna koncentracija IPTG dosegla 0,6 mmol/L, ekspresija proteina je najveća, a razlika u ekspresiji proteina nije bila značajna u različitim vremenskim intervalima (1, 2, 3, 4, 5, 6 i 7 h). Pročišćavanje rekombinantnih proteina SDS-PAGE analizom pokazalo je da postoje proteinske trake na oko 89 kDa, koje su imale istu molekulsku masu sa fuzijskim proteinom pET-30a-DS i visoke čistoće (slika 2).


SDS-PAGE analiza DS ekspresije u E.coli. Traka M: marker molekularne težine Traka 1: sirovi ekstrakti ćelija neinduciranog E. coli Rosetta koja sadrži pET-30a Traka 2: ekstrakti sirovih ćelija nakon 4 h nakon indukcije bez IPTG E. coli Rosetta koja sadrži pET-30a-His-DS traka 3–9: sirovi ćelijski ekstrakti nakon 4 h nakon indukcije s IPTG-om E. coli Rozeta koja sadrži pET-30a-His-DS. Molekularne težine novih proteinskih komponenti dobro se slažu sa onima predviđenim za fuzione proteine.


Rezultat pročišćavanja rekombinantnog proteina. Lane Ms: marker molekularne težine proteina Lane1: sirovi ekstrakti ćelija neinduciranog E. coli Rosetta koja sadrži pET-30a Traka 2: ekstrakti sirovih ćelija nakon 4 h nakon indukcije bez IPTG E. coli Rosetta koja sadrži pET-30a-His-DS Lane3: sirovi ekstrakti ćelija nakon 4 h nakon indukcije sa IPTG-om E. coli Rozeta koja sadrži pET-30a-His-DS. Lane4: pročišćeni rekombinantni protein DS. Prečišćena molekularna masa spojena sa His-tag proteinom dobro se slaže sa onima predviđenim za fuzione proteine.
3.4. Otkrivanje biološke aktivnosti rekombinantnih proteina

Dammarendiol je identificiran ekstrakcijskom jonskom hromatografijom LC-MS i vrijeme zadržavanja pikova bilo je 12,0 min. Detekcija LC-MS pokazala je da se pod uslovom sličnih količina skvalena supstrata, s povećanjem količine DS enzima, u usporedbi sa standardnom površinom vrha dammarandiola, generacijska količina damarindiola postupno povećavala. Eksperimentalni rezultati su pokazali da se rekombinantni proteini eksprimiraju u E. coli imao aktivnost i mogao je generirati skvalen u dammarendiol. Istodobno je pronađena bliska povezanost dammarendiol sintetaze i količine generiranja ginsenozida (slika 3 i tablica 1).


(a)
(b)
(c)
(d)
(e)
(f)
(a)
(b)
(c)
(d)
(e)
(f) Dijagram toka ekstrakcije jona LC-MS masenog spektrometra (označava vrh). Vodoravna i okomita koordinata označavaju vrijeme pojavljivanja vrha i visinu vrha. (a) vrijeme najvećeg pojavljivanja standardnog uzorka dammarendiola (b) - (f) vrijeme najvećeg pojavljivanja dammarendiola u reakcijskim sustavima s različitim količinama enzima DS (količine enzima DS su 5, 10, 15, 20 i 25 μL, odn.).

4. Diskusija

Biblioteka cDNA izgrađena SMART tehnologijom osigurala je integritet informacija o biblioteci cDNA [16, 17]. Osim toga, rijetko je prijavljena takva vrsta biblioteke cDNA biblioteke petogodišnjeg korijena ginsenga. SMART tehnologija može poboljšati vjerovatnoću ekspresije i efikasnost rekombinacije gena za područje umetanja, tako da su geni male zastupljenosti u biblioteci obogaćeni, što je bilo u skladu s malim brojem ekspresije gena u separaciji korijena ginsenga. Originalni kapacitet skladištenja petogodišnje biblioteke cDNA korijena ginsenga izgrađene u ovoj studiji veći je od 106 pfu/mL -1, umetnuti fragmenti uglavnom su koncentrirani između 500 i 2500 bp, što je dostiglo standardnu ​​vrijednost biblioteke i je postavio temelj za skrining ključnih gena u putu biosinteze ginsenozida.

Prvi korak u sintezi ginsenozida je ciklizacija 2,3-oksidoskvalena u dammarendiol, katalizirana DS-om grupe oksidoskvalen ciklaze (OSC). Dammarenediol sintaza je najvažniji enzim u biosintetskom putu, koji je imao veliku važnost za sadržaj ginsenozida. Osim toga, sadržaj je bio izuzetno nizak u korijenu ginsenga [18]. U ovoj studiji je odabran stariji ginseng iz sezone bujnog rasta i metabolizma, sa relativno visokom ekspresijom svih tipova gena. DS gen otvorenog okvira za čitanje koji kodira 769 aminokiselina postignut je izgrađenom bibliotekom cDNA, pa su date reference za daljnje razumijevanje karakteristika i funkcija DS gena. Kloniranje cDNK dammarenediol sintaze u ovoj studiji omogućilo je značajan korak u proizvodnji ginsenozida dammaran tipa heterolognim ekspresionim sistemima, budući da naknadna hidroksilacija (i) i glikozilacija (i) dovode do različitih struktura ginsenozida.

Istraživanja o dobivanju proteina aktivnog ključa enzima prokariotskim ekspresionim vektorom rijetko su prijavljivana. Morita i dr. [15] su primijetili proizvodnju dammarendiola II ekspresijom PNA u ERG7-deficijentnom kvascu-mutantu (GIL77), ali njegov regulatorni mehanizam nije jasan. Ubacili smo ORF DS cDNA u vektor ekspresije pET-30a, a dammarendiol sintaza je eksprimirana i pročišćena s visokom čistoćom koja je prikazana u SDS-PAGE. Budući da sekvenca gena DS sadrži veliki broj rijetkih kodona, ekspresija u E. coli Origami B (DE3) je bio niži, a niz ekspresijskih bakterija Rosetta korišten je za poboljšanje količine ekspresije. Razlog je bio taj što je plazmid PRARE2 bio nošen u bakterijama Rosetta, koji bi mogao dopuniti tRNA koja odgovara sedam rijetkih kodona koji su odsutni u E. coli, a u usporedbi s Origami B (DE3) bakterijom bio je prikladniji za ekspresiju proteina koji sadrže rijetki kodon [19, 20].

Na temelju gore navedenih istraživanja, LC-MS tehnologijom analizirana je količina stvaranja dammarendiola u različitim količinama reakcije DS enzima. LC/MS metoda je imala visoku specifičnost, osjetljivost, tačnost i druge prednosti, sa opsegom detekcije od 2,0 ng·mL -1 [21, 22]. LC-MS analiza otkrila je da se pod sličnom količinom supstrata skvalena, s odgovarajućim smanjenjem količine DS enzima, generira količina dammarendiola postupno povećavala, što je pokazalo da je rekombinantni protein izražen u E. coli imao aktivnost. Eksperimenti su dalje dokazali blisku korelaciju između damarendiol sintetaze i proizvodnje saponina in vitro, ali specifična katalitička aktivnost još nije bila jasna. Han i dr. [23] proučavali su gen ginsenga DS pomoću RNA interferencije i otkrili da je RNA interferencija DS dovela do smanjenja proizvodnje ginsenozida na 84,5% u P. ginseng korijena, što je bilo vrlo slično nalazima ove studije. Ovi rezultati pokazuju da će prekomjerna ekspresija DS-a biti korisna za pojačanu proizvodnju farmakološki važnih ginsenozida iz P. ginseng ili druge biljne vrste genetskom transformacijom.

Zaključno, ova studija dodatno je objasnila da DS gen igra ključnu ulogu u putu biosinteze ginsenozida, nakupljanje ginsenozida nije bilo odvojivo od ključnih promjena nivoa ekspresije gena, u određenoj mjeri moglo je odrediti trend biosinteze triterpenskog saponina, a DS je bio jedan od ključni enzimi u kontroli sinteze ginsenozida. Stoga je poboljšanje ekspresije gena ginsenga DS tehnologijom genetskog inženjeringa najvjerojatnije bilo učinkovito sredstvo za povećanje količine ginsenozida. Stoga, naša studija pruža osnovne eksperimentalne podatke dostupne za proučavanje DS gena i također pruža teorijsku referencu za postdubinsko proučavanje funkcije DS gena i regulatornog mehanizma na biosintetskom putu ginsenozida.

Sukob interesa

Autori izjavljuju da nemaju sukob interesa.

Priznanja

Ovaj rad je podržan od strane Nacionalne fondacije za prirodne nauke Kine (30570185 i 31070316).

Reference

  1. D. F. Qu, H. J. Yu, Z. Liu i sur., "Ginsenoside Rg1 pojačava imunološki odgovor induciran rekombinantnim Toxoplasma gondii SAG1 antigenom," Veterinary Parasitology, vol. 179, br. 1𠄳, str. 28–34, 2011. Pogledaj na: Site izdavača | Google naučnik
  2. R. Zhao, Z. Zhang, Y. Song, D. Wang, J. Qi i S. Wen, “Implikacije fosfatidilinozitol-3 kinaze/Akt/glikogen sintaze kinaze-3β put u slabljenju neuro-toksičnosti i tau fosforilacije izazvane beta-amiloidom ginsenozidom Rb1, ” Časopis za etnofarmakologiju, vol. 133, br. 3, str. 1109–1116, 2011. Pogledajte na: Izdavačka stranica | Google naučnik
  3. Y. C. Kim, S. R. Kim, G. J. Markelonis i T. H. Oh, “Ginsenosides Rb1 i Rg3 štite kultivirane kortikalne ćelije štakora od neurodegeneracije izazvane glutamatom,” Journal of Neuroscience Research, vol. 53, br. 4, str. 426–432, 1998. Pogled na: Izdavačka stranica | Google naučnik
  4. H. Dang, Y. Chen, X. Liu et al., “Antidepresivni efekti ukupnih saponina ginsenga u testu prisilnog plivanja i hroničnim blagim stresnim modelima depresije,” Napredak u neuro-psihofarmakologiji i biološkoj psihijatriji, vol. 33, br. 8, str. 1417–1424, 2009. Pogledajte na: Izdavačka stranica | Google naučnik
  5. J. Liu, K. Shimizu, H. Yu, C. Zhang, F. Jin i R. Kondo, „Stereospecifičnost hidroksilne grupe na C-20 u antiproliferativnom djelovanju ginsenozida Rh2 na stanice raka prostate,“ Fitoterapia, vol. 81, br. 7, str. 902–905, 2010. Pogledajte na: Izdavačka stranica | Google naučnik
  6. Z. Chen i Z. Gang, "Napredak u istraživanju farmakoloških učinaka ginsenozida Rd", Kineski časopis za nove droge, vol. 20, br. 11, str. 953–958, 2011. Pogledajte na: Google Scholar
  7. H. Chun Xi, Z. Shou Jing, L. Yan Long i W. Jian Hua, „Napredak u genetskoj transformaciji Panax ginseng,” China Biotechnology, vol. 29, br. 9, str. 91–96, 2009. Pogledajte na: Google Scholar
  8. Y. Liang, S. Zhao i X. Zhang, „Antisense potiskivanje cikloartenol sintaze dovodi do povišenih razina ginsenozida u Panax ginseng dlakavi korijeni,” Reporter o molekularnoj biologiji biljaka, vol. 27, br. 3, str. 298–304, 2009. Pogledajte na: Izdavačka stranica | Google naučnik
  9. M. H. Lee, J. H. Jeong, J. W. Seo i sur., „Poboljšana biosinteza triterpena i fitosterola u Panax ginseng prekomjerna ekspresija gena skvalen sintaze”, Fiziologija biljaka i ćelija, vol. 45, br. 8, str. 976–984, 2004. Pogledati na: Google Scholar
  10. Y. S. Kim, J. Y. Han, S. Lim i Y. E. Choi, „Metabolički inženjering ginsenga: regulacija gena vezanih za biosintezu ginsenozida“, Časopis za istraživanje ljekovitih biljaka, vol. 3, br. 13, str. 1270–1276, 2009. Pogledajte na: Google Scholar
  11. J. M. Augustin, V. Kuzina, S. B. Andersen i S. Bak, „Molekularne aktivnosti, biosinteza i evolucija triterpenoidnih saponina“, Phytochemistry, vol. 72, br. 6, str. 435–457, 2011. Pogledajte na: Izdavačka stranica | Google naučnik
  12. T. Kushiro, Y. Ohno, M. Shibuya i Y. Ebizuka, „In vitro konverzija 2,3-oksidoskvalena u dammarendiol pomoću Panax ginseng mikrozomi” Biološki i farmaceutski bilten, vol. 20, br. 3, str. 292–294, 1997. Pogled na: Google Scholar
  13. I. Iturbe-Ormaetxe, K. Haralampidis, K. Papadopoulou i A. E. Osbourn, “Molekularno kloniranje i karakterizacija triterpenskih sintaza iz Medicago truncatula i Lotus japonicus,” Plant Molecular Biology, vol. 51, br. 5, str. 731–743, 2003. Pogledajte na: Izdavačka stranica | Google naučnik
  14. H. Hayashi, P. Huang, A. Kirakosyan i dr., „Kloniranje i karakterizacija kodiranja cDNA β-amirin sintaza uključena u biosintezu glicirizina i sojasaponina u sladiću, Biološki i farmaceutski bilten, vol. 24, br. 8, str. 912–916, 2001. Pogledajte na: Izdavačka stranica | Google naučnik
  15. M. Morita, M. Shibuya, T. Kushiro, K. Masuda i Y. Ebizuka, „Molekularno kloniranje i funkcionalna ekspresija triterpenskih sintaza iz graška (Pisum sativum): novo α-enzim koji proizvodi amirin je multifunkcionalna triterpenska sintaza, Evropski časopis za biohemiju, vol. 267, br. 12, str. 3453–3460, 2000. Pogledajte na: Izdavačka stranica | Google naučnik
  16. R. Wellenreuther, I. Schupp, A. Poustka i S. Wiemann, “SMART amplifikacija u kombinaciji sa frakcionisanjem veličine cDNK kako bi se dobili veliki klonovi pune dužine,” BMC Genomics, vol. 5, br. 1, str. 36, 2004.Pogledaj na: Web mjesto izdavača | Google naučnik
  17. G. K. Fu i L. L. Stuve, "Poboljšana metoda za izgradnju biblioteka cDNA obogaćene cijelom dužinom," BioTechniques, vol. 34, br. 5, str. 954–957, 2003. Pogled na: Google Scholar
  18. P. Tansakul, M. Shibuya, T. Kushiro i Y. Ebizuka, „Dammarenediol-II sintaza, prvi namjenski enzim za biosintezu ginsenozida, u Panax ginseng,” Pisma FEBS -a, vol. 580, br. 22, str. 5143–5149, 2006. Pogledajte na: Izdavačka stranica | Google naučnik
  19. H. Dan, A. Balachandran i M. Lin, “Par vektora ekspresije escherichia coli neovisnih o vezivanju za brzo dodavanje polihistidinske afinitetne oznake na N- ili C-kraj rekombinantnih proteina,” Journal of Biomolecular Techniques, vol. 20, br. 5, str. 241–248, 2009. Pogledajte na: Google Scholar
  20. T. Ke, S. Liang, J. Huang i sar., „Nova metoda zasnovana na PCR-u za visoku prokariotsku ekspresiju antimikrobnih peptidnih gena,“ BMC Biotechnology, vol. 12, članak 10, 2012. Pogledajte na: Google Scholar
  21. M. Vogeser i F. Kirchhoff, “Napredak u automatizaciji LC-MS u laboratorijskoj medicini,” Clinical Biochemistry, vol. 44, br. 1, str. 4–13, 2011. Pogledajte na: Izdavačka stranica | Google naučnik
  22. A. Preis, L. Mugisha, B. Hauser, A. Weltring i T. Deschner, „Nivoi androgena i metabolita androgena u serumu i urinu istočnoafričkih šimpanzi (Pan troglodytes schweinfurthii): poređenje EIA i LC-MS analiza, ” Opća i uporedna endokrinologija, vol. 174, br. 3, str. 335–343, 2011. Pogled na: Stranica izdavača | Google naučnik
  23. J. Y. Han, Y. S. Kwon, D. C. Yang, Y. R. Jung i Y. E. Choi, “Utišavanje gena dammarendiol sintaze izazvano ekspresijom i interferencijom RNA u Panax ginseng,” Fiziologija biljaka i ćelija, vol. 47, br. 12, str. 1653–1662, 2006. Pogled na: Stranica izdavača | Google naučnik

Copyright

Autorsko pravo © 2013. Wei Hu et al. Ovo je članak s otvorenim pristupom distribuiran pod Licencom za dodjeljivanje autorskih prava Creative Commons, koji dopušta neograničenu upotrebu, distribuciju i reprodukciju na bilo kojem mediju, pod uvjetom da je izvorno djelo pravilno citirano.


Pripadnosti

J Craig Venter Institute (JCVI), 9704 Medical Center Drive, Rockville, MD, 20850, USA

Seesandra V Rajagopala, Hsi-Kuang Huang, Jorge David Mendez-Rios, Jonathan Franca-Koh, Meher Preethi Boorgula & amp Peter Peter Uetz

Fakultet za biološke nauke, Institut za nauku i tehnologiju Nara, Ikoma, Nara, Japan

Natsuko Yamamoto, Tomoko Nakamichi & amp Hirotada Mori

Odjel za biokemiju i biofiziku, Texas A & amp M univerzitet, College Station, TX, 77843-2128, SAD

Adrienne E Zweifel & James C Hu

Nacionalni institut za tehnologiju i evaluaciju, Kazusakamatari, Kisarazu, Chiba, 292-0818, Japan

Kazutoshi Fujita & Ken-ichirou Suzuki

Odsjek za biološke nauke, Univerzitet Purdue, West Lafayette, IN, 47907, SAD

Institut za napredne bioznanosti, Univerzitet Keio, grad Tsuruoka, Yamagata, Japan

Proteros Biostructures, Martinsried, Njemačka

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Ovog autora možete potražiti i u PubMed Google znalcu

Dopisni autori


Rekombinantna DNK (rDNA)

REKOMBINANTNA DNK (rDNA)

Može se definirati kao “Promjena gena organizma primjenom in vitro procesa”.

Prvu rekombinantnu DNK konstruisali su Stanley Cohen i Harbert Boyer (1973). Izrezali su dio DNK iz plazmida koji nosi gen za rezistenciju na antibiotike u bakteriji Salmonella typhimyreum i povezali ga s plazmidom Escherichia coli. Ova rDNA je uvedena u E. coli i napravljena je za umnožavanje (kloniranje gena) stvarajući brojne replike.


Rezultati i diskusija

Veličina bakterijskih stanica široko je raspoređena u klonskoj populaciji

Zaposlili smo derivat integriran u GFP E. coli DH1, zvan BSKY, kao klonska populacija predaka. DH1, uključujući BSKY, veliki je, nitasti i ima oblik štapa i heterogenije je veličine od soja divljeg tipa, MG1655 (slika 1). Ovo svojstvo implicira da BSKY ima sposobnost evolucije do manjih veličina smanjenjem vlaknaste frakcije kao odgovor na odgovarajuće izbore bez suočavanja s fizičkim ograničenjima. Stoga smo ovaj soj smatrali odgovarajućim pretkom za provjeru je li evolucija na manju veličinu popraćena promjenama rasta. Koristili smo fluorescentno aktivirani ćelijski sortirnik (FACS) za sortiranje bakterijskih ćelija prema njihovoj relativnoj veličini, na osnovu vrijednosti raspršenosti prema naprijed (FSC) u protočnoj citometriji (slika 1B na umetanju). FSC u osnovi odražava dužinu ili najduži promjer bakterija u obliku štapića i dobro se slaže s mikroskopskim opažanjem [18]. Kao rezultat toga, veće i/ili šire distribucije veličina također su dosljedno zabilježene protočnom citometrijom i mikroskopijom. Za karakterizaciju ovih raspodjela veličina koristili smo srednje vrijednosti i standardna odstupanja na logaritamskoj skali.

Distribucija veličine ćelija dvije E. coli sojevi. (A) Dve slike sa faznim kontrastom E. coli sojevi (lijevo, MG1655, i desno, BSKY). Traka skale predstavlja 10 μm. (B) Distribucije veličine ćelija dobivene mikroskopijom. Pune i isprekidane linije označavaju BSKY i MDS42, respektivno. Umetci predstavljaju odgovarajuće distribucije veličine ćelija dobivene protočnom citometrijom.

Ponovljeni ciklusi odabira veličine ispitivani su uz širenje populacije

Polazeći od genetski identične ćelijske populacije BSKY-a, testirali smo mogućnost evolucije prema manjoj veličini ćelije kroz odabir veličine, gdje je snaga selekcije ispitivana na 2 načina (Slike 2A i B). Naši eksperimentalni krugovi sastoje se od dva jednostavna odabira, odabira veličine putem FACS -a i odabira rasta u kulturi. Ćelije čija je veličina zadovoljavala kriterije odabira predstavljale su veću sposobnost odabira veličine, a brže rastuće ćelije prirodno su nadmašivale sporo rastuće ćelije u kulturama. Ćelije su uzorkovane iz kulture preko noći, a određene frakcije koje pokazuju ciljnu veličinu sortirane su u svježi medij pomoću FACS -a. Odabir veličine ispitivan je u najmanjih 1% ćelija (ozbiljna selekcija) i oko vrha (blaga selekcija) kako bi se dobile linije Svr i Mld. Broj sortiranih ćelija je određen na osnovu brzine rasta iz prethodne runde, tako da su dostigli približno 10 7 ćelija/ml nakon kultivisanja preko noći. Tipične vrijednosti su bile 20 do 2000 ćelija u 1 ml svježe podloge. U skladu s malim veličinama populacije, koncentracije ćelija su se mijenjale iz dana u dan, čak i u općenito serijskim prijenosnim ćelijama (T-linija) (Slika 3A). Ove runde ponavljale su se svakodnevno, paralelno s T-linijom, koja nije sortirana prema veličini pomoću FACS-a i korištena je kao kontrola (slika 2C). Detaljnije procedure opisane su u odjeljku Metode.

Sheme eksperimentalnih evolucijskih strategija. Rugovi usmjerene evolucije veličine sastoje se od odabira veličine pomoću sortera ćelija i naknadnog odabira rasta u ćelijskoj kulturi. Odabir veličine definiran je kao najmanji 1% populacije (Svr-loza, (A)) i to oko vrha (Mld-loza, (B)). Kao kontrola, T-loza se sastoji od selekcije rasta bez odabira veličine (C). Detaljan postupak opisan je u glavnom tekstu.

Evolucijski proces i konačne populacije evoluiranih loza. Putanja koncentracije ćelije (A), srednja veličina ćelije (B) i standardnu ​​devijaciju (C) u procesu odabira veličine. Otvoreni dijamant, otvoreni krug i zatvoreni krug predstavljaju Svr-, Mld- i T-lozu, respektivno. (D) Raspodjela veličine ćelija populacije posljednje runde (lijevo) i izolovanih 12 klonova (desno), gdje se izolati razlikuju po sivim linijama. Gornja dva panela predstavljaju klonove predaka. Ostale ploče odgovaraju linijama T-, Svr- i Mld na dnu. Umetci predstavljaju ID ćelije u Tabeli 1. Svi podaci su dobijeni pri približno 10 7 ćelija/ml. Isprekidana linija označava jedan od AC izolovanih klonova (gore lijevo). (E) Prikazane su slike faznog kontrasta izoliranih klonova. Umetci predstavljaju i ID ćelije u Tabeli 1. Bijele trake označavaju 10 μm. (Ž) Srednja veličina ćelije 12 izolata. (G) Standardna devijacija veličine 12 izolata. Trake grešaka su granice pouzdanosti od 95%. P-vrijednosti su za t-test (N = 12).

Veličina bakterijskih stanica se smanjila, a homogenost povećala

Tokom ciklusa odabira primijetili smo promjene u distribuciji veličina (slike 3B i C). U liniji Svr, prosječna veličina ćelija smanjila se nakon 15 dana (190 generacija), postigavši ​​smanjenje od 2,2 puta u usporedbi s linijom T posljednjeg dana (288 generacija) (slika 3B). Nasuprot tome, srednja veličina ćelija u lozi Mld pokazala je samo blago smanjenje. Ovi rezultati su u skladu s jačinom odabira veličine. Također smo otkrili da su se varijacije u Mld-lozi počele smanjivati ​​nakon 4 dana (57 generacija), u odnosu na Svr- i T-loze (Slika 3C).

Nakon 22 dana (ili 22 kruga), dobili smo populacije stanica iz svake loze (T22P, Svr22P i Mld22P). Osim toga, izolirali smo 12 klonskih populacija iz svake loze (T22Cs, Svr22Cs i Mld22Cs, Tablica 1). Zatim smo uporedili distribuciju ovih populacija sa distribucijom predačke populacije (AP) i njenih klonova (AC) (slika 3D). Raspodjela ovih izolata dobivena je direktno iz konačnih kultura preko noći, bez drugog odabira veličine posredovanog FACS-om (vidi odjeljak Metode). T22P je pokazao sličnu distribuciju veličine kao AC i izolati. T22C su također zadržali svoju distribuciju veličine. Ovaj nalaz ukazuje na to da je distribucija veličine, u nedostatku izbora veličine, ostala konstantna u prisutnosti odabira rasta kroz stotine generacija. Nasuprot tome, otkrili smo da su svi klonovi u Svr- i Mld-lozi (Svr22Cs i Mld22Cs) evoluirali u veličini, prema dizajnu odabira veličine (slika 3D-G), kao i distribucije Svr22P i Mld22P. To jest, distribucije Svr22Cs su otkrile znatno smanjene srednje veličine ćelija, a one Mld22Cs su bile blago smanjene (slika 3F). Obje loze su evolucijski smanjile nitaste subpopulacije. Ovi rezultati također zaključuju da veličina ćelija može pokazati nasljednost sličnu majci, budući da bi male stanice trebale stvarati male potomke, koje su slične stanicama sa starim polom koje rastu sporije [19].

Također smo otkrili da su se varijacije u Svr- i Mld-lozama smanjile, ali u različitoj mjeri (Slika 3G). Varijacije u Mld22C su se znatno smanjile, dok su se u Svr22C blago smanjile. Izbor oko vrha možda je stabilizirao distribuciju veličine, smanjujući varijacije u veličini. Ova evoluirana svojstva potvrđena su direktnim mikroskopskim posmatranjem (slika 3E, dodatna datoteka 1: slika S1 i dodatna datoteka 2: slika S2). Ovi rezultati ukazuju na to da bi veličina bakterijske ćelije mogla evoluirati jednostavnim postupkom selekcije, ne samo u prosjeku, već i zanimljivo, također u varijacijama između stanica, čak i u klonskoj populaciji.

Razvijene ćelije zadržale su malu veličinu, neovisno o koncentraciji stanica

Budući da su odabiri veličine dizajnirani da rade na veličini ćelije pri određenim koncentracijama ćelija i određenim frakcijama distribucije, ne mogu otkriti da li su se evoluirane osobine pojavile pri različitim koncentracijama ćelija ili izvan srednje vrijednosti (Slike 2 i 4). Zapravo, veličina ćelije se može mijenjati s vremenom, koncentracijom ćelija i/ili fazama rasta. Veličina bakterijskih ćelija počinje se smanjivati ​​nakon kasne log faze rasta [20]. Tako smo istražili raspodjelu veličine 12 klonova pri različitim koncentracijama stanica zajedno s krivuljama rasta. Za svaku distribuciju, u svakoj vremenskoj točki, analizirali smo višetočkovnim praćenjem srednje vrijednosti, gornjih 1% i donjih 1% linija (slika 4A), gdje su ove referentne linije bile ograničene odabirom veličine. Ove tri reference su nacrtane na različitim koncentracijama ćelija (Slike 4B i D). Za sve klonove, kao što se očekivalo, uključujući gornju i donju liniju, srednja veličina ćelije predaka počela je da se smanjuje kako su se koncentracije ćelija povećavale, mnogo prije nego što su kulture napustile fazu eksponencijalnog rasta (krajnje lijevo na slici 4C). T22Cs je pokazao sličnu ovisnost o koncentraciji stanica kao i klonovi predaka u svakoj tački (2. slijeva na slici 4C).

Ovisnost o koncentraciji ćelije od veličine ćelije. (A) Referentne linije distribucije veličine ćelije. Tamno sivi, svijetlosivi i otvoreni simboli označavaju donjih 1%, srednju i gornjih 1% raspodjele veličine. (B) Ove reprezentativne slike iscrtavaju tri reference (donja, srednja i gornja) iznad koncentracije ćelija. Dva lijeva panela predstavljaju raspodjelu veličina za klon predaka dobivenu pri različitim koncentracijama ćelija u istoj kulturi rasta. Koncentracije su navedene na umetku. Tri reference su ucrtane u desnu ploču zajedno s odgovarajućim koncentracijama ćelija, kako je označeno strelicama. (C) Prikazane su reference distribucije veličine ćelija u različitim koncentracijama ćelija za izolovanih 12 klonova od pretka (krajnje lijevo), T-loze (2. slijeva), Svr-loze (2. s desne strane) i Mld-loze ( krajnje desno) populacije. Svaki panel uključuje distribuciju AC (krug), dok su ostali klonovi označeni kvadratima.

Nasuprot tome, svi evoluirani klonovi u Svr- i Mld-lozama pokazali su svoja evoluirana svojstva ispod 10 8 ćelija/ml i imali su različite ovisnosti o koncentraciji stanica. Veličina ćelija Svr22Cs bila je mala u srednjoj vrijednosti, kao i gornjih 1% i donjih 1% linija (2. zdesna na slici 4C) i postale su blago neosetljive na ćelijske koncentracije, u odnosu na klonove predaka. Mld22C su značajno postali gusti oko srednje vrijednosti i zadržali svoju veličinu ćelije u različitim koncentracijama ćelija (krajnje desno na slici 4C). Dakle, odabir veličine pri određenoj koncentraciji stanice potiče evoluciju veličine pri različitim koncentracijama stanica.

Dalje smo testirali da li je odabir veličine neophodan za održavanje ovih evoluiranih osobina. Da bismo odgovorili na ovo pitanje, nasumično smo odabrali 12 izolata iz svake loze i razmnožavali ih 5 dana u nedostatku odabira veličine. Svi izolati su zadržali odgovarajuće osobine veličine u različitim koncentracijama ćelija (Dodatna datoteka 3: Slika S3).

Ponovnim sekvenciranjem cijelog genoma otkriveno je nekoliko mutacija u genima povezanim s rastom

Da bismo razumjeli koje vrste mutacija uzrokuju evoluciju veličine, ispitali smo ponovni niz genoma za sve 4 populacije (AC, T22P, Svr22P i Mld22P, Tablica 2). Identificirali smo samo jedan SNP, koji je pronađen u kodirajućoj regiji fosfatid -citidililtransferaze, cdsA, u Svr22P. Ovaj SNP je nesinonimna mutacija koja rezultira supstitucijom aminokiseline iz Glu u Lys na 109. ostatku. U Mld22P smo također pronašli umetanje jedne baze u kodirajuću regiju transketolaze, tktA. Ovo umetanje također nije sinonimno, ali s pomakom okvira iz Lys658. Uzimajući u obzir stopu mutacija (5,4 × 10−10 po bp po generaciji [21], [22]), veličinu genoma (4,6 × 10 6 bp) i broj generacija (200–400), očekivalo se da će evoluirana populacija imati 5,4 × 10 −10 × 4,6 × 10 6 × (200–400)

0,5-1 mutacija po pojedincu. Ova vrijednost se racionalno slaže s malim brojem mutacija koje doprinose promjenama veličine stanica. Stoga smo pretpostavili da je ovih nekoliko mutacija po osobi odgovarajući kandidati za inhibiciju filamentacije. Efektivna veličina populacije data harmoničnom sredinom prenosnih veličina (200–2000) i konačnih veličina populacije (1 × 10 7 –1 × 10 8 ) svakog dana bila je otprilike 200–2000, gdje su konačne veličine populacije svakog dana prikazane na slici 3A. Stoga 0,5-1 mutacija po pojedincu pomnoženo sa 200-2000 (jedinki) daje 100-2000 mutacija u populaciji bez selekcije. Ove procjene potvrđuju da su mutacije koje mijenjaju veličinu ćelije bile relativno česte, što ukazuje na brzinu evolucije veličine ćelije u tipičnim bakterijskim populacijama s velikom populacijom.

Ova dva gena sudjeluju na različitim putevima, cdsA za biosintezu fosfolipida i tktA za put pentoznog fosfata (slika 5). cdsA neophodan je za rast stanica jer kodirani enzim osigurava fosfolipide za izgradnju stanične membrane. Dakle, ako SNP napravi cdsA neispravan, mala veličina ćelija mutanata je funkcionalno relevantna. Nedavno istraživanje pokazalo je da je mutant oštećen u biosintezi masnih kiselina, koji je uzvodni put biosinteze fosfolipida, pokazao malu veličinu ćelija u odnosu na MG1655 [13]. Uloga tktA nije bitan, ali povezuje mnoge važne puteve rasta, poput biosinteze masnih kiselina, biosinteze aromatskih aminokiselina, biosinteze aromatskih vitamina, biosinteze nukleinskih kiselina i glikolize. Upregulated tktA potiče proizvodnju acetil-CoA i NADPH, uz povećanje ćelijske mase [23]. Osim toga, nivo ekspresije tktA je smanjen u fazi stacionarnog rasta, vjerovatno zbog sigma faktora, rpoS, koji je povezan s malom veličinom ćelije [24]. Pod pretpostavkom da je snižena regulacija ili nedostatak tktA inhibira biosintezu masnih kiselina kroz nedostatak NADPH, mutanta defektnog tktA tada ne mogu izgraditi ćelijsku membranu na sličan način kao i defektna cdsA.

Uloge ciljanih gena u sintezi membrane. U genima su identificirane dvije genomske mutacije tktA i cdsA, koji su uključeni u sintezu membrane iz metabolizma glukoze.U metaboličkom toku od sinteze glukoze do membrane, TktA je uključen u pentozofosfatni put za proizvodnju NADPH, koji je neophodan za sintezu masnih kiselina. Koristeći masne kiseline, CdsA je uključen u sintezu membranskih fosfolipida, praćenu konstrukcijom membrane, što utiče na veličinu ćelije.

Razvoj veličine ćelija nije povezan sa nedostatkom rasta

Ako je veličina ćelije populacije predaka prethodno evoluirala ili optimizirana za rast, odabir veličine može je poremetiti kao rezultat evolucijskih kompromisa. Kao što je gore navedeno, opažena stopa rasta populacije u krugovima selekcije može biti pristrasna početnim odabirima veličine. Stoga smo istražili karakteristike rasta svih evoluiranih klonova bez odabira veličine (slika 6). Zanimljivo je da je stopa rasta Svr22C bila gotovo ista kao AC ili T22C, u fazi log. Također smo otkrili da su Mld22C rasli brže od predaka bez obzira na prisutnost odabira veličine (slika 6B). Ovi rezultati pokazuju da evolucija srednje veličine ćelije nije nužno povezana s opterećenjem rasta. Odnosno, evolucija veličine ćelije mogla bi se postići bez jakih ograničenja, poput kompromisa između veličine ćelije i brzine rasta. Ovaj zaključak podržava labavo povezivanje veličine ćelije i brzine rasta, kao što je prethodno primijećeno u dugoročnoj evoluciji veličine u Lenskijevoj skupini [16].

Karakteristike rasta evoluiranih klonova. (A) Prosječna krivulja rasta 12 klonova izoliranih od predaka (lijevi vrh), T-linije (desni vrh), Svr-loze (lijevo dolje) i Mld-loze (desno dole) populacija. Sivi krugovi u nultom vremenu označavaju procijenjenu koncentraciju ćelija iz postupka inokulacije. Svaki panel uključuje krivulju rasta AC -ova (otvoreni krug), dok su ostali klonovi označeni ispunjenim crnim krugovima. Trake grešaka predstavljaju standardne devijacije, a većina traka je vrlo mala. (B) Stopa rasta 12 izolovanih klonova za fazu eksponencijalnog rasta. Stopa rasta izračunava se iz nagiba krivulja rasta tokom faze eksponencijalnog rasta. Trake grešaka su granice pouzdanosti od 95%. P-vrijednosti su za t-test (N = 12).

Brza evolucija veličina ćelija podrazumijeva strategije preživljavanja u prirodnom okruženju

Veličina bakterijske ćelije igra važnu ulogu u preživljavanju u različitim uvjetima okoline, kao što su dostupnost nutrijenata i grabežljivac [5]. Na primjer, neke bakterije različitih vrsta koriste strategiju smanjenja veličine ili filamentacije radi zaštite od grabežljivosti protista [2], [25]. Uočena kratkoročna evolucijska promjena različitih veličina može doprinijeti održivosti kroz fluktuirajući pritisak na ispaši ili dostupnost hranljivih materija u prirodnom okruženju. Budući da je trofodinamika, zasnovana na ispaši i dostupnosti hranjivih tvari, u divljini prilično složena, evolucija veličine mogla bi biti važna ili čak povoljna. Prethodna terenska istraživanja istraživala su polimorfizam veličine unutar nekih genotipova [26], [27]. Mikrobi mogu postići potpunu sposobnost prilagođavanjem svoje distribucije veličine radi rješavanja složene trofodinamike.

Usmjerena evolucija prema većoj veličini može se dogoditi bez nedostataka rasta

Da li je moguće evoluirati prema većoj veličini bez defekata u rastu, baš kao i evolucija ka manjoj veličini? Neki bakterijski sojevi pokazuju velike filamentozne morfotipove koji doprinose strategijama protiv grabežljivaca. Primjenom kapije za sortiranje za ćelije velike veličine, može se testirati usmjerena evolucija prema većoj veličini. U principu, filamentozni morfotipovi se mogu postići na dva ekstremna načina: lančani oblik od nekoliko ćelija bez povećanja volumena svake ćelije i izduženi oblik pojedinačnih ćelija sa rezultatom povećanja volumena ćelije. Obje vrste su primijećene kod nekoliko bakterija, u određenim uvjetima. Zbog tehničkih ograničenja razvrstavanja ćelija, ova dva tipa nisu se mogla razlikovati po uzorcima raspršenja svjetlosti. Stoga, ishod evolucije može ovisiti o konkurenciji rasta između ova dva tipa. Ipak, pokušali smo uvesti evoluciju u ćelije velikih niti bez defekata rasta (L-linija, Dodatna datoteka 4: Slika S4 i Dodatna datoteka 5: Slika S5A-C). Nakon 22 dana, distribucije veličine nisu se promijenile u odnosu na pretke (Dodatna datoteka 5: Slika S5D). Mikroskopskim opažanjem, međutim, otkriveno je da lanac ima najveći dio dužih ćelija (dodatna datoteka 5: slika S5E). Bojenje membrane FM4-64 pokazalo je nekoliko membranskih pregrada između svakog staničnog odjeljka u jednoj niti (Dodatna datoteka 6: Slika S6). Štaviše, pojedinačne veličine ćelija unutar filamenta ostale su nepromijenjene. Tako je najjednostavniji režim selekcije uveo vlaknasti morfotip, ali nije uspio uvesti evoluciju na veći volumen između pregrada, u kratkom vremenskom okviru.

Pored instrumentalnog ograničenja u odabiru velikih veličina ćelija u filamentu, jedan od mogućih razloga za ishod je da lančani oblik s mnogo dijeljenih septa pruža prednost rasta odmah nakon sortiranja ćelija u odnosu na singularnu, izduženu formu. Kako bismo izbjegli takva pretpostavljena nadmetanja u rastu izazvana nepreciznošću sortiranja i eliminirali obmanjujuće morfotipove, ispitali smo alternativni režim selekcije (Ls-ciklus, Dodatni fajl 7: Slika S7). Osim odabira rasta tijekom razmnožavanja, revidirana metoda sastojala se od sortiranja po jedno stanici za populacije s najvećom veličinom ćelija. Sortiranje u jednoj ćeliji moglo bi izolovati mogućeg mutanta od lančanih oblika, koji su skloni da se odmah podijele. Moguće ograničenje ove metode je, međutim, da jednoćelijsko usko grlo može omogućiti slučajnu fiksaciju mutanata s nedostatkom rasta u odnosu na pretke genetskim driftom. Međutim, nakon 8 dana, stanice su pokazale veće distribucije veličina bez defekata rasta tijekom eksponencijalne faze, prije nego su se nakupile štetne mutacije (Dodatna datoteka 8: Slika S8 i Dodatna datoteka 9: Slika S9). Mikroskopskim opažanjima otkriven je dugačak, nitasti oblik, sastavljen od izduženih ćelija u većini slučajeva (Dodatne datoteke 1, 2 i Dodatna datoteka 8: Slika S8F). Neki filamenti sadržavali su membranske pregrade, ali su razmaci između pregrada bili širi od onih stanica u L-liniji, što je u skladu s produženjem svake ćelije. Tako je revidirani režim odabira u Ls-liniji doveo evoluciju do veće veličine unutar 139 generacija bez nedostataka rasta.

Klonski izolati iz evoluirane populacije u Ls-lozi također su pokazali veliku veličinu (Dodatna datoteka 8: Slika S8E). Osim toga, ovi izolati zadržali su svoju veliku veličinu nakon 5 dana (80–90 generacija) razmnožavanja u nedostatku odabira veličine (Dodatna datoteka 3 i Dodatna datoteka 10: Slika S10). Ovi rezultati ukazuju da je evoluirana velika veličina bila nasljedna. Nažalost, ponovno sekvenciranje cijelog genoma nije otkrilo značajne zamjene parova baza niti male insercije i delecije. Stoga bi bile potrebne daljnje analize ili vrhunske tehnike za otkrivanje mogućih genetskih potpisa.


Biotehnologija: Principi i procesi Klasa 12 MCQ pitanja s odgovorima

Pitanja tipa višestrukog izbora

Pitanje 1.
Mikroorganizmi se mogu uzgajati u bioreaktorima pomoću
(a) Podržati sistem rasta
(b) Sistem uznemirenog rasta
(c) Suspendovani sistem rasta
(d) Oba (a) i (c)

Pitanje 2.
Navedite lijek koji se koristi u liječenju raka proizveden upotrebom biotehnologije
(a) Terramicin
(b) HGH
(c) Insulin
(d) TSH
(e) Enterferon

Pitanje 3.
Za vrijeme „kloniranja gena“ koje se naziva „taksi gena“?
(a) Vakcina
(b) Plazmid
(c) Bakterija
(d) Protozoe

Pitanje 4.
Tehnologija hibridoma uspješno se koristi u
(a) proizvodnja somatskih hibrida
(b) sinteza monoklonskih antitela
(c) sintezu hemoglobina
(d) proizvodnja alkohola na veliko

Odgovor: (b) sinteza monoklonskih antitijela

Pitanje 5.
Uvođenje prehrambenih biljaka razvijenih genetskim inženjeringom nije poželjno jer
(a) Ovi proizvodi su manje ukusni u odnosu na već postojeće
(b) Metoda je skupa
(c) Ekonomija zemalja u razvoju može patiti.
(d) Postoji opasnost od ulaska virusa i toksina sa unesenim usjevima

Odgovor: (a) Ovi proizvodi su manje ukusni u odnosu na već postojeće

Pitanje 6.
Hibridomske ćelije su
(a) Nervne ćelije žabe
(b) Hibridne ćelije nastale iz ćelija mijeloma
(c) Samo ćelije koje imaju onkogene
(d) Proizvod stvaranja spora u bakterijama

Odgovor: (b) Hibridne ćelije nastale iz ćelija mijeloma

Pitanje 7.
Novi soj bakterija proizveden biotehnologijom u industriji alkohola je
(a) Escherichia coli
(b) Saccharomyces cerevisiae
(c) Bacillus sabtilis
(d) Pseudomonas putida

Odgovor: (d) Pseudomonas putida

Pitanje 8.
Važan cilj biotehnologije u sektoru poljoprivrede je
(a) Za proizvodnju biljaka otpornih na štetočine
(b) Povećati sadržaj dušika
(c) Za smanjenje broja sjemena
(d) Povećati težinu biljke

Odgovor: (a) Za proizvodnju sorti biljaka otpornih na štetočine

Pitanje 9.
Dva biotehnološki proizvedena vitamina su
(a) Vitamin B12 i vitamin B6
(b) Vitamin B12 i vitamin B2
(c) Vitamin B6 i vitamin B2
(d) Vitamin B12 i vitamin B9

Odgovor: (b) Vitamin B12 i vitamin B2

Pitanje 10.
Neke patogene bakterije razvijaju rezistenciju na antibiotike
(a) Modifikovanje njihovih ćelijskih zidova
(b) Razvijanje takvih enzima koji modifikuju antibiotike
(c) Promijeniti cilj antibiotika zbog spontane mutacije
(d) Sve gore navedeno.

Pitanje 11.
Koji je prvi sisavac na svijetu uspješno kloniran iz odrasle ćelije?
(a) Ovce
(b) Majmun
(c) Krava
(d) Tele

Pitanje 12.
Koji su od navedenih organela povezani s genetskim, inženjerskim?
(a) Plazmidi
(b) Plastidi
(c) Hloroplast
(d) Mitohondrije

Pitanje 13.
Šta je cDNK?
(a) Kružna DNK
(b) Klonirana DNK
(c) DNK proizvedena reverznom transkripcijom RNK
(d) citoplazmatska DNK

Odgovor: (c) DNK proizvedena reverznom transkripcijom RNK

Pitanje 14.
Enzim EcoR-1 se dobija iz
(a) Virus
(b) Salmonela
(c) E.Coli
(d) Penicillium

Pitanje 15.
Prvi vještački hibrid biljaka napravljen je oko 1717. godine
(a) dijete Thomas Fair
(b) De Vries
(c) Borlaug
(d) Ništa od ovoga

Odgovor: (a) Thomas Fair dijete

Pitanje 16.
Gen je in vitro sintetizovan pomoću
(a) Khorana
(b) Očoa
(c) Hollay
(d) Nirenberg

Pitanje 1.
Jednoćelijski protein (SCP) pruža vrijedan bogat dodatak u ………………. dijeta.

Odgovor: Agrobacterium tumefaciens

Pitanje 3.
Omekšavanje voća u rajčici potiče enzim … … … … … …. koji razgrađuje pektin.

Pitanje 4.
Vakcina za ………………. je nedavno proizveden genetskim inženjeringom.

Pitanje 5.
Genetski proizvedeni humani inzulin naziva se … … … … … ….

Odgovor: Waksman i Woodruff

Odgovor: žitarice, povrće i kvasac

Pitanje 1.
Podrijetlo replikacije odgovorno je za pokretanje replikacije kromosoma.

Pitanje 2.
Endonukleaze su napravile rez na kraju lanca DNK.

Pitanje 3.
Etidijum bromid je sredstvo za bojenje u elektroforezi.

Pitanje 4.
Plazmidi su prisutni u jednom broju u bakterijskoj ćeliji.

Pitanje 5.
Hloramfenikol se koristi kao marker pri odabiru trans-formata u genetskom inženjeringu.

Pitanje 6.
DNK je hidrofobni molekul.

Pitanje 7.
Mikroinjekcija se koristi za ligaciju fragmenata DNK.

Pitanje 8.
Genski pištolj koristi se za ubrizgavanje DNK u ćelije domaćina.

Pitanje 9.
Hitinaza se koristi za otapanje ćelijskog zida gljivice.

Pitanje 10.
Ekstrakcija fenolom se koristi za pročišćavanje uzorka DNK.

Pitanje 1.
Kako se zovu organski spojevi koje stvara mikroorganizam koji inhibiraju rast ili ubijaju drugi mikroorganizam?

Pitanje 2.
Koji se enzim najčešće koristi za poboljšanje usjeva u genetskom inženjeringu?

Odgovor: Restrikcijske endonukleaze.

Pitanje 3.
Šta znači EFB?

Odgovor: Evropska federacija za biotehnologiju.

Pitanje 4.
Koja se tehnika koristi za proizvodnju više kopija gena?

Odgovor: PCR: Lančana reakcija polimeraze.

Pitanje 5.
Šta su molekularne škare?

Odgovor: Restrikcijski enzimi.

Pitanje 6.
Ko je napravio prvu rekombinantnu DNK?

Odgovor: 1972., Stanley Cohen i Herbert Boyer.

Pitanje 7.
Imenujte specifičnu baznu sekvencu u kojoj se restrikcijski enzimi seku

Odgovor: Slijed prepoznavanja.

Pitanje 8.
Imenujte DNK sekvencu parova baza koja na dva lanca glasi isto ako je orijentacija ista.

Pitanje 9.
U kojem smjeru će se DNK kretati u elektroforezi u agaroznom gelu?

Odgovor: Prema anodi (pozitivna elektroda).

Pitanje 10.
Koliko je velika proizvodnja biohemijskih jedinjenja?

Kolona I Kolona II
1. Ti-plazmid A. Sastavni dio bakterijskog kromosoma
2. Bakteriofagi B. Retrovirusi
3. Jedan kružni DNK molekul C. Agrobacterium
4. Virusi sposobni za reverznu transkripciju D. Proteinski omotač virusa
5. Capsid E. Virusi koji inficiraju bakterije
Odgovori

Kolona I Kolona II
1. Ti-plazmid C. Agrobacterium
2. Bakteriofagi E. Virusi koji inficiraju bakterije
3. Jedan kružni DNK molekul A. Sastavni dio bakterijskog kromosoma
4. Virusi sposobni za reverznu transkripciju B. Retrovirusi
5. Capsid D. Proteinski omotač virusa

Nadamo se da su informacije objavljene iznad u vezi sa NCERT MCQ pitanjima za 11. klasu biologije, poglavlje 11 Biotehnologija: principi i procesi sa odgovorima, besplatno preuzimanje u PDF formatu bile korisne u određenoj mjeri. Ako imate bilo kakva druga pitanja o biološkoj biotehnologiji CBSE klase 12: principi i procesi MCQ pitanja sa višestrukim izborom i odgovorima, slobodno nas kontaktirajte kako bismo nam se mogli vratiti što je prije moguće.


Pogledajte video: . Escherichia coli (Februar 2023).