Informacije

Izlučivanje i metabolički otpad?

Izlučivanje i metabolički otpad?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Znam da postoji razlika između probavnog i metaboličkog otpada, ali koja se zove izlučivanje? A kako se zove drugi? Hvala!


Egestija je izbacivanje neprobavljene hrane koja se obično javlja kroz anus. Iako, zanimljivo ili možda samo odvratno, ravni crvi moraju koristiti usta jer nemaju anus. Ovo je ne-metaboliziran materijal.

Izlučivanje je prijenos bilo kojeg metaboliziranog materijala u okoliš, uključujući urin ili ugljični dioksid.


13) Izlučivanje kod ljudi

Izlučivanje je uklanjanje sljedećih tvari:

  • otrovnih materijala
  • otpadni proizvodi metabolizma
  • višak tvari iz organizama

Višak aminokiselina se deaminira u jetri kako bi se formirao glikogen i urea. Urea se krvlju uklanja iz tkiva, a bubrezi izbacuju.

  • Jetra – Razgrađuje višak aminokiselina i proizvodi ureu.
  • Pluća – Riješite se CO2 i H2O pri izdisaju.
  • Bubrezi – Uklanja ureu i druge azotne otpadne tvari iz krvi, te izbacuje višak vode, soli. Hormoni i lijekovi.
  • Koža – Gubi vodu, so, ureu, ali ne i organ za izlučivanje.

Jetra i njena uloga u proizvodnji proteina:

  • Ima važnu ulogu u asimilacija (apsorbirajuće) aminokiseline.
  • Uklanja aminokiseline iz krvotoka i izgrađuje ih u proteine.
  • Proteini su dugi lanci aminokiselina, spojeni zajedno peptidnim vezama.

Deaminacija: je uklanjanje dijela aminokiselina koji sadrži dušik kako bi se formirala urea.

  • Urin se uzima iz bubrega u bešike od strane ureteri.
  • Uretra je cijev koja odvodi urin iz tijela.
  • Neki spojevi nastali u reakcijama u tijelu potencijalno su otrovni ako se povećaju njihove koncentracije.
  • CO2 se otapa u tekućinama kao što su tkivna tekućina i krvna plazma i tvore ugljičnu kiselinu. Ovo povećanje kiselosti može uticati na djelovanje enzima i može biti fatalno.
  • Amonijak nastaje u jetri pri razgradnji viška aminokiselina. Međutim, amonijak je vrlo alkalni i toksičan. Pretvara se u ureu koja je mnogo manje otrovna, što je čini sigurnim načinom izlučivanja viška dušika.

Mikroskopska struktura bubrega:

  • Bubrežno tkivo sastoji se od mnogih kapilara i sićušnih cijevi, tzv bubrežnih tubula, drže zajedno sa vezivnim tkivom.
  • The korteks je tamna, vanjska regija.
  • The medulla je lakša, unutrašnja zona.
  • Bubrežna arterija prenosi krv do bubrega, a bubrežna vena je odvodi.
  • Ureter prenosi urin iz bubrega u mjehur.
  • Tamo gdje se ureter spoji s bubregom postoji prostor koji se naziva zdjelica.
  • Bubrežna arterija dijeli se na veliki broj arteriola i kapilara, uglavnom u kori.
  • Svaka arteriola vodi do a glomerula. Ovo je kapilara koja se više puta dijeli i namotava, čineći čvor posuda.
  • Svaki glomerulus je gotovo u potpunosti okružen organom u obliku čaše koji se naziva a bubrežna kapsula, što dovodi do namotanog bubrežnih tubula.
  • Ova cevčica, nakon niza namotaja i petlji, spaja a sabirni kanal, koji prolazi kroz medulu da bi se otvorio u karlicu.
  • A nephron je jedan glomerulus sa bubrežnom kapsulom, bubrežnim tubulima i krvnim kapilarama.
  • Krvni tlak u glomerulu uzrokuje curenje dijela krvne plazme kroz zidove kapilara.
  • Crvena krvna zrnca i proteini plazme su preveliki da izađu iz kapilare, tako da je tekućina koja filtrira plazma bez proteina.
  • Tekućina se stoga sastoji uglavnom od vode s otopljenim solima, glukoze, uree i mokraćne kiseline.
  • Proces kojim se tečnost filtrira iz tijela pomoću glomerula naziva se ultrafiltracija.
  • Filtrat iz glomerula se skuplja u bubrežnoj kapsuli i curi niz bubrežne tubule.
  • Dok to čini, kapilare koje okružuju tubulu upijaju natrag u krv te tvari koje su tijelu potrebne.
  • Prvo se sva glukoza reapsorbira, s većinom vode.
  • Zatim se neke soli uzimaju nazad kako bi se održala ispravna koncentracija u krvi.
  • Proces apsorpcije natrag tvari koje su potrebne tijelu naziva se selektivna reapsorpcija.
  • Molekuli koji nisu selektivno reapsorbirani nastavljaju se duž tubula nefrona kao urin.

Aparat za dijalizu (vještački bubreg):

Dijaliza je tretman koji filtrira i čisti krv pomoću aparata

  • koncentracija glukoze slična normalnoj razini u krvi
  • koncentracija iona slična onoj u normalnoj krvnoj plazmi
  • nema uree

Kako u dijaliznoj tekućini nema uree, postoji veliki gradijent koncentracije – što znači da se urea kreće difuzijom kroz djelomično propusnu membranu, od krvi do tekućine za dijalizu.

Kako tekućina za dijalizu sadrži koncentraciju glukoze jednaku normalnom nivou šećera u krvi, to sprječava neto kretanje glukoze kroz membranu jer ne postoji koncentracijski gradijent.

Kako tekućina za dijalizu sadrži koncentraciju iona sličnu idealnoj koncentraciji u krvnoj plazmi, kretanje iona kroz membranu događa se samo tamo gdje postoji neravnoteža.


ULOGA BUBREGA | Histologija bubrega

Uvod

Izlučivanje uključuje odvajanje i uklanjanje metaboličkih otpadnih tvari iz tijela. U ovaj proces su uključeni različiti organi: pluća, škrge, koža, itd. Bubrezi i njihovi kanali su glavni organi za izlučivanje punog radnog vremena i čine ekskretorni sistem.

Osim eliminacije metaboličkog otpada, ekskretorni sistem funkcioniše iu održavanju odgovarajuće ravnoteže vode u organizmu: ravnoteže vode, neorganskih soli i drugih supstanci u unutrašnjem okruženju organizma. Postoji velika razlika u problemima ravnoteže vode s kojima se susreću morski, slatkovodni i kopneni kralježnjaci, a izvanredno je da su im bubrezi podjednako slični.

Bubreg svih kralježnjaka sastoji se od čvorova krvnih žila, bilo glomerula ili glomera, blisko povezanih s masom bubrežnih tubula ( Slike 1(a), 1(b), i 2 ). Jedan tubul, sa pripadajućim krvnim sudovima, je nefron.

Slika 1. Mikrofotografije dijela bubrega bodljikavog soma (Squalus acanthias). (a) Tri glomerula (pojedinačni, glomeruli) s desne strane okruženi su masom bubrežnih tubula. Delikatni kapilari (ne vide se) prodiru u rastresito vezivno tkivo između tubula. 10 ×. (b) Jedan od glomerula iz (a) okružen je nefričkom kapsulom (Bowmanova kapsula). Kapsula se sastoji od jednostavnog plosnatog epitela i podsjeća na balon koji je glomerul gurnuo tako da je svaka kapilara prekrivena visceralnim slojem nefričke kapsule, a prostor zatvoren parijetalnim slojem. Mase bubrežnih tubula ispunjavaju preostalo polje. Povremeno se pojavljuju kapilare između tubula 40 ×.

Slika 2. Mikrografi koji pokazuju kapilarne petlje u bubrežnim tijelima slatkovodne teleost ribe (Carassius auratus gibelio) Gore: Mikrofotografija dijela koji prikazuje dobro razvijen kapilarni čvor sa mnogo petlji i široko patentiranom svjetlošću. AA, aferentna arteriola sa jukstaglomerularnim ćelijama (strelice). Skala = 10 μm. Dolje: Skenirajuća elektronska mikrografija površine kapilarnih petlji sa sportskim loptastim podocitima iz kojih se protežu primarni i sekundarni procesi stopala. Skala = 10 μm.

Iz Elger M i Hentschel H (1981) Glomerulus stentohalin slatkovodne teleost, Carassius auratus gibelio, prilagođeno slanoj vodi. Skenirajuća i prijenosna elektronsko-mikroskopska studija. Istraživanje ćelija i tkiva 220: 73–85 .


Izlučivanje i metabolički otpad? - Biologija

Audesirk / Audesirk: Život na Zemlji Poglavlje 21: Ishrana, probava i izlučivanje

Koje hranjive tvari su potrebne životinjama?

A. Hranljive materije za životinje spadaju u pet velikih klasa: ugljeni hidrati, lipidi, proteini, minerali, vitamini.

1. Ovi nutrijenti osiguravaju tijelu njegove osnovne potrebe: a. energije za poticanje staničnog metabolizma i aktivnosti

b. hemijski gradivni blokovi, poput aminokiselina, za izgradnju složenih molekula jedinstvenih za svaki organizam

c. minerali i vitamini koji sudjeluju u raznim metaboličkim reakcijama.

1. Složeni ugljeni hidrati su glavni izvor energije koja se unosi u organizam. Životinje, uključujući ljude, pohranjuju ugljikohidrat zvan glikogen (visoko razgranati lanac molekula glukoze) u jetri i mišićima. To se kasnije razgrađuje u glukozu, glavni izvor energije dostupne pojedinim stanicama.

2. Jednostavni šećeri nemaju vlakna niti vitamine i minerale.

1. Fosfolipidi i kolesterol važni su sastojci membrana, masti su rezerve energije i osiguravaju izolaciju i amortizaciju.

2. Masti čine 40 posto američke prehrane, trebale bi biti manje od 30 posto.

3. Tijelu je potrebno vrlo malo polinezasićenih masti za opskrbu esencijalnim masnim kiselinama, onima koje tijelo ne proizvodi samo. Ljudi nisu u stanju sintetizirati linolnu kiselinu, koja je potrebna za sintezu određenih fosfolipida, pa moramo nabaviti ovu esencijalnu masnu kiselinu.

4. Holesterol se koristi u sintezi žučnih kiselina i polnih hormona, ali previše izaziva oštećenje krvožilnog sistema.

1. Razgradnjom proteina nastaje otpadni proizvod urea koji se filtrira iz krvi putem bubrega. Specijalizirane dijete u kojima su proteini glavni izvor energije dodatno opterećuju bubrege. Glavna uloga proteina u hrani izvor je aminokiselina za stvaranje novih molekula.

2. Od dvadeset različitih aminokiselina u proteinima, devet je esencijalnih. Odnosno, mora se ishraniti hranom kao što su meso, mlijeko, jaja, kukuruz, pasulj i soja. Budući da mnogim biljnim bjelančevinama nedostaju neke od esencijalnih aminokiselina, pojedinci na vegetarijanskoj prehrani moraju uključivati ​​različite biljke čiji proteini zajedno neće osigurati ništa, ili će riskirati nedostatak proteina.

1. Životinje zahtijevaju široku paletu minerala koji su mali neorganski molekuli i elementi

2. Minerali se moraju dobiti hranom, bilo hranom ili otopljeni u vodi.

3. Potrebni minerali uključuju:

a. Ca, Mg, P (kosti i zubi)

b. Na, K (kontrakcija mišića i provođenje živčanih impulsa)

c. Fe (proizvodnja hemoglobina)

d. I (nalazi se u hormonima koje proizvodi štitna žlijezda)

e. potrebne su i tragovi cinka, bakra i selena.

1. Ljudima su potrebne male količine od najmanje trinaest organskih molekula zvanih vitamini da pomognu u ćelijskom metabolizmu.

2. Vitamini se ne mogu sintetizirati u tijelu (u adekvatnim količinama) i moraju se unositi iz hrane.

3. Ljudski vitamini su grupisani u dvije kategorije: rastvorljivi u vodi i rastvorljivi u mastima.

4. Vitamini topljivi u vodi uključuju vitamin C i jedanaest različitih spojeva koji čine kompleks vitamina B koji se otapa u krvi i izlučuje bubrezima. Ovi vitamini općenito djeluju zajedno s enzimima kako bi promovirali kemijske reakcije koje opskrbljuju energiju ili sintetiziraju materijale.

5. Vitamini A, D, E i K rastvorljivi u mastima mogu se skladištiti u telesnoj masti i vremenom se mogu akumulirati u telu. Konkretno, vitamin K pomaže u regulaciji zgrušavanja krvi, a vitamin A se koristi za proizvodnju vizualnog pigmenta za oko. Vitamini rastvorljivi u mastima mogu biti toksični ako se konzumiraju u previsokim dozama.

O. Rani ljudi jeli su voće i povrće, a današnji ljudi jedu hranu punu masti, šećera i soli.

B. Preporučene proporcije u ljudskoj ishrani su:

1. Složeni ugljeni hidrati: 58-60%

2. Proteini: 12-15%

3. Masti i ostali lipidi: 20-25%

C. Uravnotežena prehrana obično će zadovoljiti sve zahtjeve za ove tvari. Prekomjerni unos je barem rasipan, a u najgorem slučaju štetan.

O. Energija hranjivih tvari mjeri se u kalorijama. Kalorija je količina energije potrebna da se temperatura 1 grama vode podigne za 1 stepen Celzijusa. Sadržaj kalorija u hrani mjeri se jedinicama kalorija (1000 kalorija).

B. Da bi se održala prihvatljiva težina, unos kalorija mora uravnotežiti izlaznu energiju. Ljudsko tijelo u mirovanju sagorijeva 1550 kalorija dnevno. Vježbanje značajno povećava potrebe za kalorijama.

C. Kalorijske potrebe se mogu procijeniti množenjem željene težine sa 10 (neaktivna osoba), ili 15 (umjereno aktivna), ili 20 (vrlo aktivna), a zatim se oduzima od 0 do 400, ovisno o dobi.

Godine 25-34 oduzmite nulu.

Od 35-44 godine oduzeti 100

Godine 45-54 oduzmite 200.

Godine 55-64 oduzmite 300.

Preko 65 oduzmi 400.

D. Gojaznost je višak masti u masnom tkivu tijela po definiciji koji se odnosi na osobe koje su 25 posto teže od idealnog.

Ishrana i organski metabolizam

O. Molekule hranjivih tvari se miješaju i miješaju nakon što se apsorbiraju.

B. Ubrzo nakon obroka, nivo ugljikohidrata raste, neki se pretvaraju u masti radi skladištenja, a drugi se pretvaraju u glikogen u jetri i mišićnom tkivu.

C. Između obroka, nivoi glukoze se održavaju razgradnjom rezervi glikogena u jetri i aminokiseline se pretvaraju u glukozne masne kiseline iz masti koje ćelije mogu direktno koristiti za energiju.

D. Jetra je vrijedan organ za pretvaranje hranjivih tvari i detoksikaciju kemikalija.

1. Probavni sistem je unutrašnji prostor ili cijev sa specijalizovanim područjima za transport, obradu i skladištenje hrane. a. Nepotpun probavni sistem ima jedan otvor.

b. Kompletan probavni sistem je cijev sa dva otvora, koji omogućavaju da se hrana kreće u jednom smjeru kroz lumen.

2. Probavni sistem obavlja ovih pet funkcija:

a. Gutanje: hrana se mora unijeti u probavni organ

b. Mehanički kvar: hrana se mora fizički razgraditi na komade, pomiješati i transportovati.

c. Hemijski raspad: čestice hrane moraju biti izložene enzimima i hormonima koji uzrokuju razgradnju velikih molekula na manje molekule sposobne preći crijevnu sluznicu.

d. Apsorpcija: male molekule se moraju transportovati iz organa za varenje u krv i limfu.

e. Eliminacija je izbacivanje nesvarenih i neapsorbiranih ostataka na kraju crijeva.

1. Unutarćelijska probava: jednom kada je proguta ćelija, hrana je zatvorena u vakuoli hrane. Vakuola hrane se kasnije spaja sa lizosomima i hrana se razlaže unutar vakuole na manje molekule koji se mogu apsorbirati u ćelijsku citoplazmu.

2. Izvanstanična probava:

a. Gastrovaskularna šupljina koja se nalazi kod cnidarija, kao što su morska anemona, hidra i meduza, je oblik ekstracelularne probave. Hrana koja se hvata pipcima unosi u gastrovaskularnu šupljinu gdje je enzimi razgrađuju. Stanice koje oblažu šupljinu apsorbiraju hranjive tvari i proždiru male čestice hrane gdje dolazi do daljnje probave unutarstaničnom probavom. Nesvareni ostaci se na kraju izbacuju kroz isti otvor kroz koji su ušli.

b. Varenje u cijevi: ljudi i drugi kralježnjaci imaju cjevaste probavne puteve s nekoliko odjeljaka u kojima se hrana prvo fizički, a zatim kemijski razgrađuje prije nego što je apsorbiraju pojedine stanice. Životinje s cjevastim probavnim traktom koriste izvanćelijsku probavu za razgradnju hrane.

3. Regionalna specijalizacija u korelaciji je s ponašanjem hranjenja.

a. Preživari (na primjer, krave) mogu stalno jesti travu i imati više želudaca za varenje celuloze.

b. Želuci preživača imaju četiri komore. Prva komora, burag, evoluirala je u masivnu fermentacijsku bačvu koja uključuje mnoge vrste bakterija i cilijata koje napreduju u obostrano korisnom odnosu sa preživačem. Ovi mikroorganizmi proizvode celulazu, enzim koji razgrađuje celulozu na šećere koji se nalaze u njoj.

c. Životinje s diskontinuiranim prehrambenim navikama mogu imati organe za skladištenje. odnosno veverice

Ljudski probavni sistem (Tabela 29-6)

Poglavlje 21 Odjeljak 3 / Laboratorijski priručnik Poglavlje 17.1

O. Ljudski probavni sistem je duži od 20 stopa.

1. Specijalizirane regije uključuju usta, ždrijelo, jednjak, želudac, tanko crijevo, debelo crijevo, rektum i anus.

2. Dodatne žlijezde uključuju žlijezde slinovnice, jetru (sa žučnim mjehurom) i gušteraču.

Urinarni sistem i homeostaza

A. Volumen i sastav izvanćelijske tečnosti, koja se sastoji od intersticijske tečnosti koja okružuje žive ćelije i krvi u sudovima, mokraćni sistem održava u prihvatljivim granicama.

B. Urinarni sistem sisara pomaže u održavanju homeostaze na nekoliko načina:

1. Reguliše nivo jona u krvi kao što su natrijum, kalijum, hlorid i kalcijum.

2. Reguliše sadržaj vode u krvi

3. Održava pravilan pH krvi.

4. Zadržavanje važnih nutrijenata kao što su glukoza i aminokiseline u krvi.

5. Luči hormone kao što je eritropoetin koji stimuliše proizvodnju crvenih krvnih zrnaca

6. Eliminiše ćelijske otpadne proizvode kao što je urea.

1. Voda se dobija pomoću dva procesa: a. Apsorpcija vode iz tečnosti i čvrste hrane se dešava u gastrointestinalnom traktu.

b. Metabolizam hranjivih tvari daje vodu kao nusprodukt.

2. Voda se gubi kroz najmanje četiri procesa:

a. Izlučivanje vode se ostvaruje izlučivanjem urina.

b. Isparavanje se javlja s respiratornih površina i kroz kožu.

c. Znojenje se javlja na površini kože.

d. Eliminacija vode u fecesu je normalna pojava.

D. Solute Dobici i gubici

1. Otopine se dodaju unutrašnjem okruženju pomoću četiri procesa: a. Hranjive tvari, mineralni ioni, lijekovi i aditivi u hrani apsorbiraju se u gastrointestinalnom traktu.

b. Sekret iz endokrinih žlijezda dodaje hormone.

c. Disanje stavlja kisik u krv.

d. Reakcije metabolizma doprinose otpadnim proizvodima.

2. Mineralni joni i metabolički otpad se gube na ova tri načina:

a. Izlučivanjem mokraće se odlaže amonijak (nastao od aminokiselina), urea (nastala u jetri spajanjem dva amonijaka) i mokraćna kiselina (iz nukleinskih kiselina).

b. Disanjem se uklanja ugljični dioksid, najzastupljeniji metabolički otpad.

c. Znojenje dovodi do gubitka mineralnih iona.

Urinarni sistem sisara

1. Bubrezi (2) filtriraju različite tvari iz krvi.

a. Većina filtrata se vraća u krv, oko 1 posto završava u urinu.

b. Bubrezi regulišu volumen i koncentraciju otopljene tvari u ekstracelularnoj tekućini.

2. Urin teče iz svakog bubrega kroz mokraćovoda do mokraćnog mjehura (radi skladištenja), a zatim iz uretre izlazi iz tijela.

3. Mokrenje je refleksni odgovor, ali se može kontrolirati nervnim i mišićnim djelovanjem.

Struktura i funkcija bubrega

O. Svaki bubreg je u obliku graha veličine šake.

1. Čvrsti sloj vezivnog tkiva, bubrežna kapsula, prekriva svaki bubreg.

2.Unutra se nalazi vanjska regija korteksa koja se nalazi iznad regije medule.

3. Nefroni koji se sastoje od krvnih kapilara i tubula filtriraju vodu i otopljene tvari iz krvi i vraćaju veliki dio.

B. Funkcionalne jedinice bubrega Nefroni

1. Filtracija se događa u glomerulusu, klupko kapilara smještenih u Bowmanovoj kapsuli.

2. Bowmanova kapsula prikuplja filtrat i usmjerava ga kroz kontinuirane tubule nefrona: proksimalnu -& gt petlju Henle -& gt distalno -& gt kanal za prikupljanje.

3. Kapilare izlaze iz glomerula, konvergiraju se, zatim se ponovo granaju u peritubularne kapilare oko tubula nefrona, gdje sudjeluju u povratku vode i bitnih otopljenih tvari.

Procesi stvaranja urina, pregled

1. U filtraciji, krvni tlak sili filtrat iz glomerularnih kapilara u Bowmanovu kapsulu, zatim u proksimalne tubule.

a. Krvne ćelije, proteini i druge velike otopljene tvari ne mogu proći kroz zid kapilara u kapsulu.

b. Voda, glukoza, natrijum i urea se istiskuju.

2. Reapsorpcija se odvija u tubularnim dijelovima nefrona, gdje se voda i otopljene tvari kreću preko zida cijevi, iz nefrona iu okolne kapilare.

3. Izlučivanje premješta tvari iz kapilara u stijenke nefrona.

a. Kapilare koje okružuju nefrone luče suvišne količine jona vodonika i kalijevih jona u tubule nefrona.

b. Ovaj proces također oslobađa tijelo od lijekova, mokraćne kiseline, proizvoda razgradnje hemoglobina i drugog otpada.

4. Urin se može koncentrirati jer postoji osmotski koncentracijski gradijent soli i uree u intersticijskoj tekućini koja okružuje Henleovu petlju.

A. Faktori koji utiču na filtriranje

1. Bubrezi mogu preraditi oko 125 ml (oko 4 oz) krvi svake minute zbog dva faktora: a. Glomerularne kapilare su visoko propusne za vodu i male otopljene tvari.

b. Krv ulazi u glomerule pod visokim pritiskom, te arteriole imaju širi promjer nego većina arteriola.

2. Brzina kojom bubrezi filtriraju određeni volumen krvi ovisi o protoku krvi kroz njih i brzini reapsorpcije u tubulima, a funkcioniraju neuronske i hormonske kontrole.

B. Reapsorpcija vode i natrijuma

1. Mehanizmi unutar bubrega pažljivo regulišu izlučivanje i zadržavanje supstanci na osnovu unosa i tjelesnih potreba. a. Natrijevi ioni se ispumpavaju iz proksimalnih tubula (filtrat) u intersticijalnu tekućinu koja okružuje peritubularne kapilare.

b. Značajne količine vode pasivno teku niz nagib koji je stvoren.

c. U silaznom udu Henleove petlje voda se osmozom istječe, ali se u uzlaznom dijelu pumpa natrij.

d. Ova interakcija udova petlje proizvodi vrlo visoku koncentraciju otopljene tvari u dubljim dijelovima bubrežne moždine i isporučuje prilično razrijeđen urin u distalni tubul.

2. Podešavanja izazvana hormonima

a. Antidiuretički hormon (ADH) iz stražnje hipofize se luči kao odgovor na smanjenje izvanstanične tekućine. ADH uzrokuje da distalni kanalići i sabirni kanali postanu propusni za vodu, koja se vraća nazad u krvne kapilare i na taj način omogućuje ponovnu apsorpciju vode iz urina .

b. S padom razine natrija i volumena izvanstanične tekućine to potiče određene bubrežne stanice na lučenje renina, koji djeluje na koru nadbubrežne žlijezde oslobađajući aldosteron koji potiče reapsorpciju natrija.

c. Kad koncentracija otopljene tvari u izvanstaničnoj tekućini poraste, centar žeđi hipotalamusa reagira smanjenjem proizvodnje sline, uzrokujući žeđ.

C. Regulacija krvnog pritiska i sadržaja kiseonika

1. Dva hormona koje proizvode bubrezi su važna u regulaciji krvnog pritiska i kapaciteta za nošenje kiseonika u krvi, renina i eritropoetina.

2. Kada krvni pritisak padne, bubrezi oslobađaju renin u krvotok. Renin djeluje kao enzim koji katalizira stvaranje drugog hormona angiotenzina. Angiotenzin zauzvrat uzrokuje sužavanje arteriola povećavajući krvni tlak.

3. Suženje arteriola koje nose krv do bubrega također smanjuje brzinu filtriranja krvi uzrokujući uklanjanje manje vode iz krvi. Zadržavanje vode uzrokuje povećanje volumena krvi, a time i povećanje krvnog tlaka.

4. Kao odgovor na nizak nivo kiseonika u krvi, bubrezi oslobađaju drugi hormon eritropoetin. Eritropoetin putuje u krvi do koštane srži gdje stimulira bržu proizvodnju crvenih krvnih stanica čija je uloga transport kisika.

A. Zadržavanje viška natrijuma i vode može dovesti do hipertenzije.

B. Naslage mokraćne kiseline, soli kalcija i drugog otpada mogu se taložiti u bubrežnoj zdjelici i stvarati bubrežne kamence. Ouch.

C. Mašine za dijalizu bubrega su potrebne ako se izgubi normalna kontrola zapremine i sastava ekstracelularne tečnosti.

1. Kod hemodijalize, aparat je spojen direktno na krvni sud radi četvorosatnog tretmana, tri puta sedmično.

2. Kod peritonealne dijalize, tekućina se stavlja u pacijentovu trbušnu šupljinu kako bi poslužila kao medij za membransku dijalizu, a zatim se drenira nakon nekog vremena.

Održavanje osnovne tjelesne temperature

O. Mnogi različiti fiziološki i bihevioralni odgovori pomažu u održavanju unutrašnje tjelesne temperature tijela.

B. Temperature pogodne za život

1. Enzimi ostaju funkcionalni u rasponu od 0 do 40 o C.

2. Iznad 41 o C dolazi do denaturacije, što enzim čini neučinkovitim.

3. Niže temperature možda neće poremetiti aktivnost, ali je usporiti za pola za svakih 10 stepeni.

1. Zračenje je dobijanje toplote iz nekog izvora, odnosno gubitak toplote iz tela u okolinu u zavisnosti od temperature okoline.

2. Kondukcija je prijenos topline s jednog objekta na drugi kada su u direktnom kontaktu, kao kada čovjek sjedi na hladnom (ili vrućem!) betonu.

3. Konvekcija je prijenos topline putem tekućine u pokretu, poput zraka ili vode.

4. Isparavanje je proces u kojem zagrijana supstanca prelazi iz tečnog u plinovito stanje, uz gubitak topline u okolinu.

Klasifikacija životinja na osnovu temperature

1. Životinje s niskim metabolizmom dobivaju toplinu iz okoliša.

2. Ektoterme, kao što su gušteri, prilagođavaju promjenjive vanjske temperature u onome što nazivamo regulacijom temperature u ponašanju.

1. Endotermi stvaraju toplinu iz metaboličkih aktivnosti, a također vrše kontrolu nad očuvanjem i rasipanjem topline.

2. Endoterme imaju prilagodbe kao što su perje, krzno ili masnoća da smanje gubitak toplote, a takođe prilagođavaju svoje ponašanje kretanjem ispod zemlje tokom dnevne vrućine, na primer.

C. Heteroterme, kao što je kolibri, stvaraju tjelesnu toplinu tokom svojih aktivnih perioda, ali liče na ektoterme u vrijeme neaktivnosti.

D. Upoređene toplotne strategije

1. Ektotermi su u prednosti u tropima gdje ne moraju trošiti mnogo energije za održavanje tjelesne temperature.

2. Endoterme imaju prednost u umjerenim do hladnim postavkama.

Regulacija temperature kod sisara

A. Odgovori na hladni stres

1. Sisavci reaguju na hladnoću sužavanjem glatkih mišića u krvnim sudovima kože (periferna vazokonstrikcija), što usporava gubitak toplote.

2. U odgovoru pilomotora, dlačice ili perje postaju uspravniji kako bi stvorili sloj mirnog zraka koji smanjuje konvektivne i zračne gubitke topline.

3. Ritmičko podrhtavanje (drhtanje) uobičajen je odgovor na prehladu, ali nije dugo djelotvoran i ima visoku cijenu metabolizma.

4. Sisavci koji hiberniraju mogu proizvesti nepromjenjivu toplinu hormonskom stimulacijom posebnog smeđeg masnog tkiva.

5. Hipotermija je stanje u kojem temperatura jezgre padne ispod normalne, što može dovesti do oštećenja mozga, a smrzavanje je lokalizirana smrt stanica uslijed smrzavanja.

B. Odgovori na toplotni stres

1. Periferna vazodilatacija je povećanje promjera krvnih žila kako bi se omogućilo da veće količine krvi dođu do kože i rasipaju toplinu.

2. Gubitak topline isparavanjem znojenjem uobičajen je i očit mehanizam hlađenja.

3. Dahtanje koriste životinje sa vrlo malom sposobnošću da se znoje.

4. Hipertermija je porast unutrašnje temperature, sa razornim efektima.

1. Tokom groznice, hipotalamus vraća tjelesni "termostat" na novu privremenu temperaturu jezgre. a. Na početku groznice, gubitak toplote se smanjuje, a proizvodnja toplote se povećava, osoba se oseća hladno.

b. Kad groznica padne, periferna vazodilatacija i znojenje se povećavaju dok tijelo pokušava smanjiti temperaturu jezgre na normalnu.

2. Čini se da kontrolirano povećanje tjelesne temperature (unutar granica) tokom groznice pojačava imunološki odgovor tijela.

Autorska prava 2000. Steven Wormsley
Posljednje ažurirano 5. januara 2000. od strane Stevena Wormsleya


Plamene ćelije Planarije i Nefridija crva

Kako su višećelijski sistemi evoluirali tako da imaju organske sisteme koji dijele metaboličke potrebe tijela, pojedinačni organi su evoluirali da obavljaju funkciju izlučivanja. Planarije su ravni crvi koji žive u slatkoj vodi. Njihov sistem za izlučivanje sastoji se od dvije tubule povezane sa visoko razgranatim sistemom kanala. Ćelije u tubulima se zovu plamene ćelije (ili protonefridije ) jer imaju skup cilija koje izgledaju kao treperavi plamen kada se gledaju pod mikroskopom, kao što je prikazano na slici 22.10 a . Cilije tjeraju otpadne tvari niz tubule i iz tijela kroz izlučujuće pore koje se otvaraju na površini tijela. Cilije također izvlače vodu iz intersticijske tekućine, omogućavajući filtriranje. Svi vrijedni metaboliti se vraćaju reapsorpcijom. Plamene ćelije nalaze se u ravnih glista, uključujući parazitske trakavice i slobodnoživuće planarije. Oni također održavaju osmotsku ravnotežu organizma.

Slika 22.10. U sistemu za izlučivanje (a) planarije, cilije plamenih ćelija potiskuju otpad kroz tubul formiran ćelijskom cevčicom. Tubule su povezane u razgranate strukture koje vode do pora koje se nalaze duž svih strana tijela. Filtrat se izlučuje kroz ove pore. U (b) anelidima kao što su gliste, tekućina za filtriranje nefridija iz celoma ili tjelesna šupljina. Tučeći cilije na otvoru nefridija izvlačite vodu iz celoma u tubul. Kako filtrat prolazi kroz tubule, nutrijenti i druge otopljene tvari se reapsorbiraju u kapilarama. Filtrirana tekućina koja sadrži dušične i druge otpadne tvari pohranjuje se u mjehuru, a zatim izlučuje kroz pore na strani tijela.

Gliste (anelidi) imaju malo razvijenije strukture izlučivanja tzv nephridia , ilustrovan na slici 22.10 b . Par nefridija prisutan je na svakom segmentu gliste. Slične su plamenim ćelijama po tome što imaju tubule sa cilijama. Izlučivanje se odvija kroz pore nazvane nefridiopore . Oni su razvijeniji od plamenih ćelija jer imaju sistem za tubularnu reapsorpciju kapilarnom mrežom prije izlučivanja.


Diskusija

Naš cilj je bio okarakterizirati glavna metabolička prilagođavanja hibernatora tijekom produženog posta pod normotermijskim uvjetima, te procijeniti moguće sezonske učinke. Ova studija pokazuje da se šumski bagrem koristi dvostrukom strategijom za suočavanje s normotermijskim postom: (1) brzo umanjuju brzinu metabolizma (osim ako već funkcioniraju na vrlo niskim stopama kao u proljeće), vjerovatno smanjujući potrošnju energije na najnižu razinu koja je još uvijek kompatibilna s normotermni život, i (2) reorganizuju svoj obrazac odabira goriva da poštede ograničene rezerve proteina.

Metabolička depresija izazvana postom

U uhranjenom stanju, stopa metabolizma je mnogo veća u ljeto nego u proljeće (+35% vidi Tablicu 1), a ovo zapažanje je u skladu s objavljenim mjerenjima na post-upijajućim drvenim šukama i svizcima (Bailey, 1965. Körtner i Heldmaier, 1995.) Rawson et al., 1998). Nakon proljetnog uzbuđenja, niska bazalna brzina metabolizma čini se kritičnom za preživljavanje normotermijskog razdoblja posta koje obično slijedi nakon 5 mjeseci hibernacije (Davis, 1967. Hamilton, 1934. Snyder i sur., 1961.). Tokom posta, metabolička depresija se koristila samo ljeti (smanjenje za 25%. O2 preko 2 sedmice Sl. 2), a to se nije dogodilo u proljeće. Ovo zapažanje ukazuje na zanimljivu mogućnost da normotermijski, bazalni metabolizam ima donju granicu. Potencijalno postojanje minimalne bazalne metaboličke stope za normotermičke sisavce potkrijepljeno je činjenicom da ljetne i proljetne šumske patke postižu istu stopu potrošnje energije nakon 14 dana posta, iako su njihove stope prije posta vrlo različite. Mjerenja na zečevima pružaju dodatnu potporu istom konceptu jer ova vrsta počinje sa mnogo većom stopom apsorpcije metabolizma od proljetnih ili ljetnih šumaraka, ali pokazuje jaču metaboličku depresiju tijekom posta (-32% u samo 7 dana). Brzo smanjenje potrošnje energije koju pokazuju zečevi nije dovoljno da u potpunosti nadoknadi njihovu visoku brzinu metabolizma nakon apsorpcije (Tablica 1, Slika 2A), pa je stoga gubitak tjelesne mase mnogo brži kod kunića (-15% u 7 dana) nego kod siva (-13% za 14 dana) (Sl. 1). Iz tog razloga, eksperimenti na zečevima morali su se prekinuti nakon jedne sedmice (u skladu s granicom koju je odredio naš odbor za brigu o životinjama), a mi nismo mogli utvrditi hoće li dulji period posta na kraju smanjiti metaboličku stopu kunića na niže razine uočeno kod šumskih škriljevca. Kod obe vrste, metabolička depresija je bila praćena malim, ali značajnim smanjenjem telesne temperature (slika 3), kao što je ranije uočeno kod drugih vrsta uključujući pacove (Ma i Foster, 1986). Poput proljetnih šumaraka, čini se da drugim sisarima s prirodno niskim bazalnim metabolizmom nedostaje sposobnost metaboličke depresije tijekom posta. Eksperimenti na oporsu Virginia Didelphis virginiana, tobolčar slične veličine tijela (3-4 kg), otkrio je da ova noćna vrsta dostiže najnižu brzinu metabolizma od ~200 μmol O2 kg -1 min -1 (ili 4,5 ml O2 kg -1 min -1) tokom dnevnog sna (vidi sliku 1 u Weber i O'Connor, 2000). Ova minimalna stopa postapsorpcije identična je najnižoj vrijednosti koja je ovdje uočena kod šikare (Slika 2A) i oposum iz Virdžinije nije u stanju dodatno smanjiti svoju stopu metabolizma kao odgovor na gladovanje (Weber i O'Connor, 2000).

Dva glavna procesa koja troše ATP i koji računaju bazalni metabolizam su trans-membransko pumpanje jona i sinteza proteina (Rolfe i Brown, 1997). Moguće je zamisliti da sisavci mogu samo smanjiti ove bitne procese na minimalnu razinu, ispod koje je ugrožen normotermički život. Na primjer, smanjenje cijene ionskog pumpanja može se postići smanjenjem ionske nepropusnosti membrana kroz promjene u stupnju zasićenja fosfolipida (Hulbert i Else, 2000). Međutim, mijenjanje zasićenja fosfolipidima također će utjecati na mnoge druge važne funkcije membrane kroz promjene u ukupnoj fluidnosti (npr. Osjetljivost na inzulin), pa tako široko rasprostranjeni poremećaji možda nisu kompatibilni sa životom sisavaca na ∼37 ° C. Drugi način da se smanji potrošnja energije tokom posta bio bi smanjenje curenja mitohondrijalnih protona, proces koji odvaja potrošnju kiseonika od fosforilacije ADP. Dvije nedavne studije pokazuju da gladovanje i ograničenje kalorija ne utiču na curenje protona (Bézaire et al., 2001. Ramsay et al., 2004.), dok druga sugerira da je curenje protona smanjeno. preko složeni mehanizmi koji variraju s trajanjem ograničenja kalorija (Bevilacqua et al., 2004). Jasno je da potencijalno postojanje minimalne normotermne metaboličke stope u endotermama, i mehanička ograničenja za njegovu specifičnu zadatu tačku, zahtijevaju daljnje istraživanje.

Promjene u izboru goriva: štedljivost proteina

Pored metaboličke depresije, produženo gladovanje ima važne efekte na odabir goriva. U našim eksperimentima velike promjene izazvane uskraćivanjem hrane dogodile su se unutar 2 dana, pa su stoga sve vrijednosti izmjerene nakon tog vremena objedinjene za svaku skupinu životinja (slika 4). Kod obje vrste, dominantna upotreba ugljikohidrata koji normalno podržavaju energetski metabolizam u postapsorpcijskom stanju (faza I) brzo je zamijenjena visokom upotrebom lipida (faza II) kako je nastavljeno gladovanje (slika 4). Međutim, najupečatljivije razlike u odabiru goriva uočene su u odnosu na uštedu proteina. U proljeće su ščuke imale najmanju stopu neto oksidacije proteina, vjerojatno zato što je njihov odabir goriva odražavao stanje hibernacije bliže nego ljeti. U nahranjenom stanju, proteini su činili samo 8% metaboličke stope kod prolećnih drvaca, dok je dostizao 17%O2 u ljetnim čamcima, i visoka vrijednost od 28%O2 kod zečeva (slika 4A). Sve grupe imale su mogućnost smanjiti apsolutne i relativne stope neto oksidacije proteina kao odgovor na post. Nakon više od 3 dana bez hrane, doprinos proteina je smanjen na 5%O2 u proljetnim šumarama 6%O2 u ljetnim mjesecima i 20%O2 kod zečeva. Zbog toga, šikare pokazuju superiornu sposobnost štedenja proteina (što se takođe odražava u mnogo nižim stopama potrošnje vode i proizvodnje urina nego zečevi, vidi sliku 6), posebno tokom leta. U ovo doba godine, oni ne samo da mogu smanjiti ukupnu potrošnju energije kako bi se nosili s postom, već i dramatično smanjiti svoje oslanjanje na proteine. Ova metabolička strategija pomaže očuvanju mišićne mase, a primijećena je i kod drugih vrsta prilagođenih za produženi post. Uzgoj odraslih tuljana i štenaca nakon odbića obično se snalaze nekoliko tjedana bez hrane smanjenjem njihove stope metabolizma na ∼45% normalnih vrijednosti kod uhranjenih životinja i oslanjanjem na proteine ​​na 6% O2(Nørdoy et al., 1993., 1990. Worthy i Lavigne, 1987.). Međutim, najekstremniji kapacitet za uštedu proteina može se naći kod medvjeda. Tokom ljeta, recesija grudnog leda sprječava polarne medvjede U. maritimus iz lovačkih tuljana i čini se da smanjuju oksidaciju proteina na 1% O2 kao odgovor na post (Atkinson et al.,1996 Nelson,1987). Crni medvjedi Ursus americanus i grizli medvjedi U. arctos snižavaju tjelesnu temperaturu za nekoliko stupnjeva i brzinu metabolizma za ∼30% tokom njihove „pseudo-hibernacije“, koja može trajati i do 6 mjeseci (Watts et al., 1981). Za to vrijeme se ne izlučuje dušični otpad (Barboza et al., 1997 Nelson, 1973, 1980 Nelson et al., 1973), a dva moguća mehanizma su pozvana da objasne ovo zapažanje: (1) potpuna inhibicija oksidacije proteina i /ili (2) recikliranje otpadnih proizvoda dušika. Noviji eksperimenti u kojima su uzorkovane biopsije mišića na početku i na kraju zime pokazuju da je razgradnja proteina medvjeda u hibernaciji zapravo značajna, ali niska (Tinker i sur., 1998).Stoga imaju sposobnost recikliranja dušika jer se otpadni proizvodi ne akumuliraju tijekom hibernacije.


Reči koje treba znati

Antidiuretski hormon: Hemikalija koju luči hipofiza i koja reguliše količinu vode koju izlučuju bubrezi.

hemodijaliza: Proces odvajanja otpada iz krvi prolaskom kroz polupropusnu membranu.

nefron: Jedinica za filtriranje bubrega.

Urea: Hemijski spoj ugljika, vodika, dušika i kisika proizveden kao otpad od strane stanica koje razgrađuju proteine.

Ureter: Cijev koja prenosi urin iz bubrega u mokraćni mjehur.

uretra: Kanal koji vodi od mokraćnog mjehura prema van tijela kroz koji se eliminira urin.

Tečnost koja sadrži otpad i koja ostaje u nefronima naziva se urin. Urin je 95 posto vode, u kojoj se rastvaraju otpadni proizvodi. Par cijevi koje se zovu ureteri nose urin iz bubrega u mokraćni mjehur. Svaki ureter je dugačak oko 16 do 18 inča (40 do 45 centimetara). Bešika je šuplja mišićna vreća koja se nalazi u karlici koja je srušena kada je prazna, ali kruškolikog oblika i proširena kada je puna. Mjehur kod odrasle osobe može zadržati više od 2 šalice (0,6 litara) urina. Mjehur ispušta urin u uretru, kanal koji vodi van tijela. Kod muškaraca, uretra je dugačka oko 8 inča (20 centimetara). Kod ženki dugačka je manje od 2 inča (5 centimetara). Mišić sfinktera oko uretre na dnu mokraćne bešike kontroliše protok urina između njih.

Volumen izlučenog urina kontrolira antidiuretski hormon (ADH), koji oslobađa hipofiza (mala žlijezda koja leži na dnu lubanje). Ako se osoba puno znoji ili ne pije dovoljno vode, posebne živčane stanice u hipotalamusu (regija mozga koja kontrolira tjelesnu temperaturu, glad i žeđ) otkrivaju nisku koncentraciju vode u krvi. Oni tada signaliziraju hipofizi da otpusti ADH u krv, odakle putuje do bubrega. Uz prisutnost ADH -a, bubrezi apsorbiraju više vode iz urina i vraćaju je u krv. Volumen urina se tako smanjuje. S druge strane, ako pojedinac unese previše vode, proizvodnja ADH se smanjuje. Bubrezi ne reapsorbuju toliko vode, a volumen urina je povećan. Alkohol inhibira proizvodnju ADH i stoga povećava izlučivanje urina.


Metode

Srednje i sojevi

Svi sojevi korišteni u ovoj studiji navedeni su u Tabeli S1. Sva nomenklatura kvasca slijedi standardnu ​​konvenciju. Za sve eksperimente, smrznuti sojevi kvasca pohranjeni na -80°C prvo su naneseni na YPD ploče (10 g/L ekstrakta kvasca, 20 g/L peptona, 20 g/L glukoze + 2% agara) i uzgajani na 30°C za otprilike 48 sati, nakon čega je jedna kolonija inokulirana u 3 mL YPD -a i uzgajana uzgajana preko noći na 30 ° C. Svi eksperimenti su izvedeni u roku od 5 dana od generisanja kulture preko noći. Minimalni medij (SD) sadržavao je 6,7 g/L azotne baze Difco kvasaca bez aminokiselina, ali s amonijevim sulfatom (Thermo Fisher Scientific, Waltham, MA, SAD) i 20 g/L D-glukoze, osim tijekom eksperimenata s ograničavanjem glukoze, u kojima niži nivoi glukoze su korišteni kako je navedeno. Medij za izgladnjivanje glukoze (S) sadržavao je samo 6,7 g/L azotne baze kvasca Difco bez aminokiselina, ali sa amonijum sulfatom. Medij za gladovanje dušikom (SD-N) sadržavao je 1,7 g/L azotne baze Difco kvasca bez aminokiselina ili amonijevog sulfata i 20 g/L D-glukoze. Ovisno o auksotrofiji soja, SD je dopunjen lizinom (164,3 μM), adenin sulfatom (108,6 μM) [74] ili organosumporom (134 μM) kako bi stanice mogle eksponencijalno rasti.

Sojevi su konstruirani ili ukrštanjem kvasca ili homolognom rekombinacijom [74,75]. Ukrštanja su obavljena parenjem roditeljskih sojeva, izvlačenjem diploida, sporulacijom, tetradnom disekcijom i selekcijom na odgovarajućim pločama. Kao primjer delecije gena, bcy1Δ soj (WY2527) je izgrađena PCR-pojačava otpornost KanMX gen iz plazmida (WSB26 [76]) pomoću prajmera WSO671 (TACAACAAGCAGATTATTTTCAAAAGACAACAGTAAGAATAAACGcagctgaagcttcgtacgc) i WSO672 (GAGAAAGGAAATTCATGTGGATTTAAGATCGCTTCCCCTTTTTACataggccactagtggatctg), sa 45-baznih parova homologije (velika) na uzvodno i nizvodno područje od BCY1 gen, respektivno. The lys − soj WY2490 je zatim transformisan sa PCR proizvodom, a transformanti su odabrani na G418 ploči. Uspješno brisanje je potvrđeno provjerom PCR-a sa prajmerom uzvodno od BCY1 gen (WSO673 TATACTGTGCTCGGATTCCG) uparen sa unutrašnjim prajmerom za pojačanu KanMX kasetu (WSO161 ctaaatgtacgggcgacagt).

Evolucija

Evolucija kokulture opisana je u ranijoj studiji [32]. Da bi se oživjela kokultura, približno 20 μL je uzeto iz zamrznutog uzorka pomoću sterilne metalne lopatice, razrijeđeno približno 10 puta u SD i ostavljeno da raste do umjerene zamućenosti 1-2 dana. Kokultura je dodatno proširena dodavanjem 3 mL SD. Evolved lys − klonovi su izolovani postavljanjem kokulture na agar bogatih podloga (YPD) sa higromicinom B.

Za evoluciju monokulture korišteni su kemostatski sudovi (S14 Sl.) (Metode, "Hemostati i turbidostati"). Da bi se stvorilo sterilno okruženje, početna montaža izvedena je u ladicama za autoklave, a posude su držane u stalcima za cijevi. Šest rezervoara je pripremljeno dodavanjem 810 mL vode u svaku bocu. Šest posuda pripremljeno je dodavanjem 10-milimetarske šipke za miješanje i 20 mL medija za rast (SD + 21 μM lizina) u svaku posudu. Cijevi za isporuku medija pričvršćene su između rezervoara i posuda putem gumenih čepova, a cijevi za otpad su bile pričvršćene na svaki ispusni krak, pri čemu je nepričvršćeni kraj prekriven folijom pričvršćenom trakom od autoklava. Epruveta za mikrocentrifugu od 1,5 mL postavljena je preko igle za uzorkovanje i pričvršćena trakom za autoklav. Otvori za cijevi su također omotani folijom. Svaki rezervoar sa pričvršćenom cijevi je izmjeren, cijeli sklop autoklaviran, a zatim je svaki rezervoar ponovo izvagan. Izgubljena voda je izračunata i vraćena. U sterilnim uslovima, 90 mL 10 × SD i zaliha lizina dodano je u svaki rezervoar kako bi se postigla konačna koncentracija lizina od 21 μM. Posude su zatim pričvršćene u kemostatske razdjelne posude, rezervoare postavljene na vagu, a cijevi uvučene u pumpe.

Predak ili evoluirao lys - klonovi su uzgajani u 50 mL SD + 164 μM lizina približno 20 sati prije inokulacije. Prije svakog eksperimenta, praćen je rast kako bi se osiguralo da ćelije rastu optimalno (približno 1,6-satno vrijeme udvostručenja). Kada ćelije dostignu gustinu od približno 0,2 OD600, ćelije su isprane 3 puta u SD i inokulirane u posudu za kemostat prethodno napunjenu sa SD + 21 μM lizina. Nakon ovog koraka, kemostatske pumpe su uključene u zadanom vremenu udvostručavanja u prilagođenom programskom paketu LabView. Svaka posuda s kemostatom sadržavala je približno 43 ml tekuće zapremine i bila je postavljena na ciljno vrijeme udvostručenja (na primjer, za 7-satno udvostručavanje, protok je 43 × ln2/7 = približno 4,25 mL/h). Razvili smo 3 linije pri 7-satnom udvostručavanju i 3 linije pri 11-satnom udvostručavanju. Sa 21 μM lizina u rezervoaru, ciljana stabilna gustina ćelija bila je 7 × 10 6 /mL. U stvarnosti, gustine živih ćelija varirale su između 4 × 10 6 /ml i 1,2 × 10 7 /ml. Povremeno se sakupljalo 4 mL supernatanta i raspršivalo u sterilnu cijev od 15 mL. Zatim je 300 μL ovog ćelijskog uzorka uklonjeno i držano na ledu radi analize protočne citometrije. Preostalih 3,7 ml supernatanta filtrirano je kroz najlonski filter od 0,22 μm u alikvote od 500 μL i zamrznuto na -80 ° C. Svaki kemostat je uzorkovan prema unaprijed postavljenoj sekvenci. Za eksperimente sa ekstrakcijom metabolita, čep kemostatske posude je uklonjen, a ćelije iz 20 mL uzorka su sakupljene (metode, "ekstrakcija metabolita"). Zbog kršenja steriliteta posuda, ovo bi označilo kraj eksperimenta s kemostatom.

Rezervoar hranljivih materija je ponovo napunjen kada je to bilo potrebno ubrizgavanjem medija kroz sterilni filter od 0,2 μm postavljen na špric od 60 mL. Za sterilno uzimanje uzoraka, cijev koja prekriva iglu za uzorkovanje pažljivo je podignuta, a na iglu je pričvršćena sterilna štrcaljka od 5 ml. Igla je zatim obrisana sa 95% etanolom i polako gurnuta nadole tako da je vrh bio najmanje približno 10 mm ispod nivoa tečnosti. U špric je uvučen uzorak od 5 ml, igla je izvučena iznad površine tečnosti, a dodatno je provučeno 1 ml vazduha da bi se igla očistila od tečnog ostatka. Štrcaljka je zatim odvojena, a zatvarač vraćen na iglu. Uzorci su izbačeni u sterilne epruvete za kulturu od 13 mm radi zamrzavanja i protočne citometrije za određivanje gustoće živih ćelija. U oba evolucijska eksperimenta, uzorci su zamrznuti u 1 dijelu 20% trehaloze u 50 mM natrijum fosfatnog pufera (pH 6,0) + 1 dio YPD. Uzorci su hlađeni na 4°C 15 minuta prije nego što su zamrznuti na -80°C.

Sekvenciranje cijelog genoma i analiza podataka su detaljno opisani u [32].

Kvantifikacija auksotrofne frekvencije

Zamrznute kulture (2 vremenske točke iz 3 evolucije monokulture i 3 eksperimenta evolucije kokulture) su oživljene, a klonovi izolirani i pregledani na auksotrofiju. Oživeli smo smrznute uzorke direktnim postavljanjem uzoraka na YPD (monokultura) ili YPD + higromicin (kokulture za odabir prema partnerskom soju). Ploče su uzgajane na 30 ° C približno 2-4 dana dok sve kolonije nisu bile lako vidljive za branje. Posmatrali smo različite veličine kolonija i pregledali i velike i male kolonije kada su bile prisutne. Brojali smo velike i male kolonije kako bismo procijenili omjer stanica koje stvaraju velike/male kolonije u populaciji, zatim pomnožili ovu frakciju s udjelom auksotrofa koji su uočeni u svakoj klasi veličine kolonije kako bismo dobili potpunu procjenu auksotrofne učestalosti populacije. Za skrining na auksotrofiju, cijele kolonije su inokulirane u 150 μL SD, od kojih je 10 μL razrijeđeno u 150 μL SD u mikrotitarskim pločama i inkubirano preko noći da bi se iscrpio prijenos organskog sumpora ili ćelijsko skladištenje organosumpora. U slučaju nekih malih kolonija, nije došlo do razrjeđivanja jer je gustoća inokuliranih ćelija već bila dovoljno niska, na osnovu mjerenja OD. Zatim je 10-30 μL razrijeđeno u konačni volumen od 150 μL svaki od SD + 164 μM lizina, SD + 164 μM lizina + 134 μM metionina i YPD -a, s ciljem da se OD od približno 0,005-0,03 na osnovu početnog očitanja OD ploča sa 96 jažica600 čitanje ploče za izgladnjivanje. Ploče su zatim inkubirane 48+ sati kako bi se kulture uzgajale do zasićenja i zamućenja kulture (OD600) očitana je pomoću čitača ploča sa 96 jažica. Kontrolni bunari poznatog lysorgS - (WY1604) i lys - (WY2226) su uključene u skrining kao kontrole. Bunari koji su rasli u SD + lizin + metionin i YPD, ali nisu uspjeli rasti u SD + lizin, ocijenjeni su kao lysorgS − .

Fluorescentna mikroskopija

Eksperimenti fluorescentne mikroskopije i analiza podataka detaljno su opisani na drugom mjestu [27]. Ukratko, mikroskop je spojen na rashlađenu CCD kameru radi fluorescencije i snimanja propuštenog svjetla. Mikroskop sadrži temperaturno kontroliranu komoru postavljenu na 30 ° C. Mikroskop je opremljen motoriziranim preklopnim kockama filtera sposobnim detektirati razne fluorofore. Takođe ima motorizovane stepenice koje omogućavaju z-autofokusiranje i sistematsko xy skeniranje lokacija u jamicama mikroploče. Snimanje slike se vrši pomoću internog LabVIEW programa, koji uključuje automatsko fokusiranje u svijetlom polju i automatsko podešavanje ekspozicije tokom fluorescentnog snimanja kako bi se izbjeglo zasićenje. Prethodna analiza [27] je pokazala da ako je fluorescencija po ćeliji konstantna tokom vremena, tada se intenzitet fluorescencije oduzet u pozadini proporcionalno mjeri s gustinom živih stanica, a smanjenje intenziteta fluorescencije dobro korelira sa smrću stanice.

Za eksperimente na Sl. 2 i S2 Sl., WY2490 (lys -) i WY2527 (lysbcy1 -) uzgajane su preko noći do eksponencijalne faze u SD + 164 μM lizina, isprane 3 puta u S medijumu i gladovale 3 sata na 30 ° C u tvornički čistim 13-milimetarskim epruvetama u SD (lizin gladovanje) ili S ( izgladnjivanje lizina i ugljika). Za snimanje, približno 10.000 ćelija po jažici je inokulisano u svaku jažicu ploče sa 96 jažica u odgovarajućem medijumu (tretman rapamicinom je urađen u SD + 1 μM rapamicinu). Ploča mikrotitra je povremeno snimana (otprilike 1-2 sata) pod 10x objektivom u Nikon Eclipse TE-2000U obrnutom fluorescentnom mikroskopu (Nikon, Tokio, Japan) pomoću ET DsRed kocke filtera (pobuđivač: ET545/30x, emiter: ET620/60m, dihroični: T570LP). Sličan protokol praćen je za eksperimente na slikama 6 i S9, S10 i S11, pri čemu su genotipovi i uvjeti gladovanja zabilježeni u odgovarajućim legendama o figurama.

Hemostati i turbidostati

Ćelije su uzgajane u kontroliranim uvjetima pomoću prilagođenog uređaja za kontinuirano uzgoj (S14A Sl.), Sa 6 kanala (S14C Sl.) Od kojih se svaki može neovisno upravljati kao kemostat ili turbidostat. Kada se koristi kao hemostat, kanal pruža ograničeno nutritivno okruženje u kojem se stopa rasta održava konstantnom. Kada radi kao turbidostat, kanal održava konstantnu gustoću stanica dok ćelije rastu s obilnom opskrbom hranjivim tvarima. Za protokole rasta ćelija u ovim uređajima, pogledajte Metode, "Evolucija".

Uređaj za kontinuirano uzgajanje sastojao se od 6 reaktorskih posuda (S14A slika, stražnja strana), svaka sa zapreminom od približno 43 mL (S14E slika) određena visinom izlazne cijevi (S14C slika). Gumeni čep opremljen dovodnom cijevi i iglom za uzorkovanje prekrivao je vrh svake posude (S14C Sl.). Posude su postavljene u aluminijski montažni okvir sa 6 posuda (S14A sl., Stražnja strana), svaka opremljena integriranom magnetskom miješalicom (napravljenom od ventilatora CPU-a) i optičkim detektorom sa LED-fototranzistorom za mjerenje vanjske temperature. Posude su imobilizirane u posudama pomoću podesivih kompresijskih prstenova. Igla za uzorkovanje je prošla kroz kratku PharMed gumenu cijev (S14C Sl.). Cijevi su pričvršćene staklenim cijevima umetnutim u čep. Rajsferšlusi se koriste za postizanje odgovarajuće čvrstoće, omogućujući kretanje igle za uzorkovanje uz primjenu dovoljno trenja za održavanje položaja. Otpad je gravitaciono dotjerao u posudu za otpad ispod uređaja kroz cijevi unutrašnjeg promjera 0,375 inča (Cole Parmer C-Flex) pričvršćene na ispusni krak. Hranjivi mediji su dovedeni u svaku posudu iz nezavisnog rezervoara pomoću peristaltičke pumpe (Welco WPM1, koja radi na 7V DC Welco, Tokio, Japan). Cijev za isporuku medija sastojala se od 2 dijela općenitog vanjskog promjera 2 mm, unutrašnjeg promjera 1 mm PTFE cijevi, spojenih umetanjem u 2 kraja 17-cm presjeka cijevi PharMed AY242409 (Saint-Gobain, Courbevoie, Francuska) koji je umetnut u peristaltičku pumpu (S14B Sl.). Pumpa je aktivirana i deaktivirana prilagođenim LabView programom preko relejne kutije (Pencom Design, UB-RLY-ISO-EXT-LR Trumbauersville, PA, SAD). U zavisnosti od toga da li je dati kanal bio u režimu hemostata ili turbidostata, program LabView je kontrolisao pumpu na različite načine (tj. Konstantna brzina razblaživanja u kemostatu ili razblaživanje do zadate zamućenosti u turbidostatu). Podaci za OD i protok su prijavljeni za bilo koji način rada. U oba slučaja, brzina protoka se može koristiti za izračunavanje stope rasta. Rezervoari za medije (S14A slika, prednja strana) su bile staklene boce od 1 L zatvorene gumenim čepovima s jednom rupom, a dio staklene cijevi je korišten kao navlaka kako bi se spriječilo uvijanje PTFE cijevi i kako bi kraj PTFE cijevi bio u dodiru s dnu rezervoara. Svaki rezervoar je postavljen na digitalnu vagu (Ohaus SPX2201 Parsippany, NJ, SAD) sa digitalnim interfejsom (Ohaus Scout RS232 interfejs) za merenje zapremine (težine) preostale u rezervoaru u bilo kom trenutku.

U turbidostatskom režimu, održavana je konstantna prosječna zamućenost. Konkretno, pumpa se aktivirala kada je izmjereni OD bio iznad zadane vrijednosti, a deaktiviran kada je OD bio ispod zadane vrijednosti. OD je mjeren pomoću 940-nm LED (Ledtech UT188X-81-940, pogonjen strujom od 50 ma Tajvan, Tajvan) i fototranzistora (Ledtech LT959X-91-0125). Svaki par LED-fototranzistor je testiran i odabran za konzistentna mjerenja OD. LED i fototranzistor postavljeni su montažnim rupama na aluminijskom metalnom okviru, na suprotnim stranama reaktorske posude, 4 cm od dna posude. Svaki fototranzistor bio je spojen na kolo op-amp (LM324) koje je djelovalo kao pretvarač struje u napon i međuspremnik (S14B Sl.). Izolovani DC-DC pretvarač je obezbjeđivao regulirani napon za elektroniku. Izlazni napon iz kola fotodetektora je digitalizovan pomoću DAQ (National Instruments USB-6009 Austin, TX, SAD) i očitan programom LabView za mjerenje OD. Program LabView pohranio je prosječan intenzitet svjetlosti I0 prve 2 minute nakon pokretanja kanala kao "prazna" vrijednost. Intenzitet svjetla, I, mjeren je svakih približno 30 s, a OD = log10(I/I0) je izračunato.

U režimu hemostata konstantan prosječni protok f medija u posudu je održavano. Za razliku od naših ranijih postavki kemostata [77], ovdje je konstantan protok postignut vagom (Ohaus SPX2201) koja je stalno vagala pripadajući spremnik, a očitanje je dobiveno putem RS232 sučelja (Ohaus Scout RS232). Početno očitavanje skale, Minicijal, je snimljen kada je kanal hemostata aktiviran ili resetovan. Ovo je korišteno sa trenutnim očitavanjem skale Mstruja za izračunavanje ukupne zapremine ispumpane iz rezervoara u posudu kao 1 ml/g × (MstrujaMinicijal). Ciljna zapremina koja je trebala preletjeti iz rezervoara u posudu u trenutnom trenutku izračunata je prema unaprijed postavljenoj brzini protoka. Ako je ukupna zapremina bila manja od ciljne, pumpa je bila aktivirana, au suprotnom, pumpa je deaktivirana. Ovo je osiguralo tačan prosječni protok. Brzina protoka je odabrana za željeno vrijeme udvostručavanja, f = ln(2) × V/TD, gdje V je volumen posude i TD vreme udvostručavanja. Zapremine posuda izračunate su vaganjem prazne posude, a zatim ponovnim vaganjem pri punjenju do točke prelijevanja (S14E Sl.), Dajući prosječnu vrijednost od 43 ml. Pojedinačne brzine protoka određene su korištenjem pojedinačnih volumena posuda. Mjerenja zapremine ograničena su minimalnom veličinom kapljice otpadne cijevi od približno 0,5 ml, koja je ograničena površinskim naponom. Očitavanja skale su evidentirana, dajući mjeru brzine protoka (S14D slika).

Biotestovi

Većina bioloških testova je zasnovana na prinosu. WY1604 (met10 -) obično je služio kao soj testera, osim ako nije drugačije navedeno u eksperimentu (vidi S5 Sl. I S1 Tabelu), ali je priprema za sve biotestove zasnovane na prinosu bila ista.Sojevi su uzgajani približno 16 sati u 3 mL SD -a, uz dodavanje bilo kakvih potrebnih dodataka. Tokom ovog vremena, praćena je stopa rasta kako bi se osiguralo da se ćelije udvostruče kako se očekivalo (udvostručavanje od 1,6 do 3 sata u zavisnosti od soja/stanja). Nakon tog vremena, ćelijama je dato 3-5 ispiranja sa 3 mL SD + 164 μM lizina (bez dodataka organskog sumpora) i izgladnjele su najmanje 3 sata na 30°C u 3 mL SD + 164 μM lizina kako bi se iscrpile stanične rezerve organosumpora. . Gladovanje je provedeno u tvornički čistoj epruveti od 13 mm kako bi se spriječila nenamjerna kontaminacija nutrijentima. Konačno, približno 1.000 ćelija/jažici je inokulirano u ploču s 96 jažica s ravnim dnom u konačni volumen od 150 μL ili standardnog metabolita ili supernatanta hemostata, dopunjenog sa SD + 164 μM lizinom. Za svaki auksotrofni soj, SD + 164 μM lizina, dopunjen različitim poznatim koncentracijama glutationa, upotrijebljen je za uspostavljanje standardne krivulje koja povezuje koncentraciju organskog sumpora (u smislu GSM ekvivalenta u fmolu) s konačnom zamućenošću (S5 Sl.). Mutnoća postignuta u supernatantu tada je korištena za zaključivanje koncentracije organskog sumpora u supernatantu. Ploče su omotane parafilmom kako bi se spriječilo isparavanje i inkubirane na 30 ° C 2-3 dana. Resuspendirali smo ćelije pomoću Thermo Fisher Scientific Teleshake -a (postavka #5 približno 1 min) i očitavali zamućenost kulture pomoću čitača ploča BioTek Synergy MX (Winooski, VT, USA).

U biotestu zasnovanom na stopi (S4B Sl.), Soj kvasca označen sa mCherry, auksotrofičan za organosulfur (WY2035), prethodno je uzgojen u SD + 164 μM lizina + 134 μM metionina, a brzina rasta praćena je optičkom gustoćom kako bi se osiguralo da ćelija raste kako očekivano. Zatim su ćelije isprane 3 puta u SD + 164 μM lizina (bez suplemenata sa sumpornom kiselinom) i gladovale najmanje 3 sata u fabrički čistim epruvetama od 13 mm. OD je ponovo izmjeren i ćelije su inokulirane na otprilike 1000 ćelija/jažici u ploči sa 96 jažica u ukupnoj zapremini od 300 μL. Bunar je ispunjen poznatim količinama organosumpora (metionin ili glutation) ili ubranim supernatantima, oboje dopunjeno SD + 164 μM lizinom. Ploča sa 96 jažica mjerena je na isti način kao što je prethodno opisano u odjeljku „Fluorescentna mikroskopija“.

Maksimalna stopa rasta izračunata je mjerenjem nagiba ln(Normalizovani intenzitet) u odnosu na vreme. Za svaki klizni prozor od 4 vremenske tačke izračunava se nagib, a ako premašuje trenutni maksimalni nagib za bunar, on se bira kao novi maksimum. Kako bismo osigurali da nema procjene kada bi drugi metaboliti, poput glukoze, mogli biti ograničavajući, ograničili smo analizu na podatke pri maksimalnom intenzitetu od 25% kako bismo osigurali da su ćelije imale najmanje 2 udvostručenja nakon što teoretski rastu maksimalno. Za biotestove zasnovane na brzini, maksimalne stope rasta su korištene za procjenu približne veličine niše.

Protočna citometrija

Detaljan opis može se pronaći na drugom mjestu [30]. Sastav stanovništva mjeren je protočnom citometrijom pomoću DxP10 (Cytek, Fremont, CA, USA). Fluorescentne kuglice poznate koncentracije (određene hemocitometrom) dodane su da bi se odredila gustina ćelija. Konačno razrjeđivanje ToPro3 od 1: 20000 (Molecular Probes T-3605 Eugene, OR, USA) korišteno je za svaki uzorak za određivanje gustoće živih i mrtvih stanica. Analiza pomoću softvera FlowJo pokazala je očigledno grupiranje živih i mrtvih ćelija u kanalu ToPro3 RedFL1, pri čemu mrtve ćelije imaju signal RedFL1 od> gt10 3. Gustina mrtvih ćelija tipično nikada nije bila veća od 10% u svim testiranim uslovima.

Ekstrakcija metabolita

Ekstrakcija metabolita za unutarstaničnu kvantifikaciju organosumpora prilagođena je iz [78]. Ukratko, 20 mL populacija hemostata sakupljeno je pipetama od 25 mL za jednokratnu upotrebu i brzo filtrirano vakuumom na prethodno izrezane 0,45 μm Magna najlonske filtere (GVS Life Sciences, Sanford, ME, SAD). Koristeći klešta očišćena etanolom, filter je zatim brzo potopljen u 3 ml ledeno hladne ekstrakcijske smjese-40% (v/v) acetonitrila, 40% (v/v) metanola i 20% (v/v) destilirane vode- drži u sterilnoj epruveti za centrifugiranje od 5 mL. Svi reagensi su bili HPLC-razreda, a sve ekstrakcijske smjese su svježe pripremljene prije svake ekstrakcije. Cijev za centrifugiranje je začepljena i brzo vrtložna kako bi se uklonile sve ćelije, a membrana filtera je odbačena. Cijeli proces trajao je manje od 25 sekundi, pri čemu je vrijeme između filtriranja populacija i potapanja u ekstrakcijski tampon manje od 10 sekundi. Nakon što su sve populacije sakupljene, ekstrakti su zamrznuti na -80°C ili u tekućem dušiku do čvrste tvari, prebačeni u led i ostavljeni da se odmrznu. Nakon što su se uzorci odmrznuli, inkubirani su na ledu 10 minuta i vrtložni jednom u približno 3 minute i vraćeni na -80 ° C radi ponovnog zamrzavanja (jedan ciklus „zamrzavanje-odmrzavanje“). Nakon 3 ciklusa zamrzavanja i odmrzavanja, 1,5 ml uzorka je sakupljeno i prebačeno u novu epruvetu za mikrocentrifugu od 1,5 ml i centrifugirano pri 13 000 o / min 2 minute na 4 ° C kako bi se zrnca ostataka ćelija. Ekstrakt je uklonjen, a preostali ćelijski pelet je ponovo ekstrahiran sa 1,5 ml smjese za ekstrakciju i centrifugiran. Konačni rezultat bio je 3 mL ekstrahiranih metabolita koji su pohranjeni na -80 ° C i analizirani HPLC -om manje od 48 sati nakon ekstrakcije. Za biotestove, ovaj ekstrakt je razrijeđen 10 puta u sterilnoj vodi ili SD. Da bi se provjerilo da je većina metabolita ekstrahirana, 100 μL svježeg pufera za ekstrakciju dodano je u prikupljene ćelijske ostatke, snažno vrtložno i sakupljeno centrifugiranjem. Ovaj 100 μL „drugog ekstrakta“ je takođe analiziran na glutation pomoću HPLC. U prosjeku, količina glutationa u drugom ekstraktu bila je <2% količine koja je prvobitno ekstrahirana u ekstrakciji od 3 mL.

Korišćen je modifikovani protokol za ade − ćelijski ekstrakti. Nezavisno smo potvrdili da su dva protokola dovela do uporedivih rezultata u met10 biološki test na bazi prinosa (S5 podaci). ade -kulture hemostata filtrirane su na 0,45 μm nitrocelulozne membrane (Bio-Rad, Hercules, CA, USA), resuspendirane u smjesi za ekstrakciju i zamrznute u tekućem dušiku. Uzorci su odmrznuti na -20°C tokom 30 minuta, uz vorteksiranje svakih 5 minuta. Ćelijski ostaci su granulirani centrifugiranjem na 13.000 o / min 10 minuta na 4 ° C. Nakon što je supernatant prebačen u svježu epruvetu, pelet je ekstrahiran sa polovinom originalne količine ekstrakcijske mješavine, a supernatanti iz 2 kruga ekstrakcije su spojeni. Ekstrakcijska smjesa je osušena korištenjem postavke niske temperature na speed-vac-u, a dehidrirane komponente su resuspendirane u sterilnoj destiliranoj vodi.

Iz ukupne količine metabolita u uzorku i ukupnog broja ćelija korištenih za ekstrakciju metabolita, možemo izračunati prosječnu količinu metabolita po ćeliji.

Kvantifikacija analitičke hemije GSH i GSX

Reducirani glutation je derivatiziran pomoću tiol-specifične sonde koju je prvi opisao [79], nazvane Thiol Probe IV (EMD Millipore, Burlington, MA, USA) kako bi se napravio fluorescentni glutation konjugat. Jedinjenje lako reaguje sa slobodnim tiolima, iako različitom brzinom. Za kvantificiranje glutationa, 270 μL uzorka ili GSH standarda u SD dodano je u 30 μL 833 mM HEPES pufera (pH 7,8). Ovo je učinjeno kako bi se pH uzorka podigao na bazni nivo, što je olakšalo reakciju. Zatim je sonda (otopljena u DMSO i pohranjena u alikvotima od 50 μL na -20°C) dodana do konačne koncentracije od 100 μM, što je više od glutationa za najmanje 10 puta. Reakcija je izvedena na sobnoj temperaturi u mraku (sonda je osjetljiva na svjetlo) u ploči sa 96 jažica 20 minuta. Nakon toga, dodano je 8,4 μL 2M HCl kako bi se reakcija brzo zaustavila snižavanjem pH na otprilike 2. Ovo također stabilizira fluorescentni konjugat. Čitav uzorak je zatim dodan umetaču klase vučene tačke male zapremine 250 μL (Agilent broj: 5183–2085 Santa Clara, CA, SAD) kako bi se olakšao pristup igli za automatsko uzorkovanje. Uložak male zapremine s uzorkom tada je stavljen u tamno smeđu bočicu za automatsko uzorkovanje od 1,5 ml (Shimadzu broj dijela: 228-45450-91 Kyoto, Japan) i zatvoren svježim 9-mm navojnim zatvaračem s PTFE pregradom (broj dijela Shimadzu: 228-45454-91).

Derivatizirani glutation je odvojen i identificiran reverznofaznom hromatografijom. 10 μL reakcione smeše ubrizgano je u Synergi 4-μM Hydro-RP 80-Å LC kolonu, 150 × 4,6 mm (Phenomenex, br. Dela: 00F-4375-E0 Torrance, CA, SAD), opremljenu zaštitnim patronama SecurityGuard AQ C18 4 x 3,00 mm ID (Phenomenex, br. Dela: AJO-7511) u držaču patrone SecurityGuard (Phenomenex, br. Dela: KJ0-4282). SecurityGuard (predkolona) povremeno se mijenjao kad god je očitavanje tlaka premašilo specifikacije proizvođača. Glutation je eluiran iz kolone mobilnim faznim gradijentom filtrirane Millipore vode (rastvor A) i acetonitrila (rastvor B, HPLC-razred). Millipore voda je filtrirana kroz filter od 0,22 μM prije upotrebe. Dodatno, prije svakog ciklusa, kolona je ekvilibrirana 30 minuta sa 1% otopinom B. Procenat otopine B slijedio je sljedeći program za svaku injekciju: 0 min 1%, 10 min 14%, 10,01 min 1% i 15 min 1%, što odgovara postepenom povećanju na 14% rastvora B tokom 10 minuta, nakon čega je usledila ponovna ekvilibracija sa 1% rastvora B. Kolona je održavana na radnoj temperaturi od 25°C u pećnici Nexera X2 CTO-20A ( Shimadzu). Brzina protoka je bila 1 mL/min. Pod ovim uslovima, glutation je eluirao na približno 7 minuta, uz neznatne varijacije od početka do kraja. Fluorescentni glutation otkriven je pobudom na 400 nm i emisijom na 465 nm. Nakon svakog ciklusa, kolona je isprana i pohranjena prema uputama proizvođača.

Analiza HPLC podataka je urađena korištenjem R Statistical Language sa prilagođenim softverom za odabir pikova, korekciju osnovne linije, crtanje i procjenu površine, koji je besplatno dostupan na

Supernatanti su preko noći isporučeni na suhom ledu u laboratoriju Rabinowitz na Sveučilištu Princeton. Stabilno izotopsko jedinjenje [2- 13 C, 15 N] GSH dobijeno je iz Cambridge Isotope Laboratories. Voda, metanol i acetonitril HPLC-razreda dobiveni su od Thermo Fisher Scientific-a. Uzorak supernatanta je odmrznut na sobnoj temperaturi i 30 μL supernatanta zajedno sa 5 μL 10 μM 2- 13 C + 15 N-označenog GSH je prebačeno u epruvetu za centrifugu od 1,5 mL. Uzorci su ili direktno rađeni da se izmjeri samo GSH ili prvo tretirani tris(2-karboksietil)fosfinom (TCEP) da se GSX reducira na GSH prije mjerenja ukupnog GSH. Za one uzorke sa TCEP tretmanom, 5 μL 60 g/L rastvora TCEP (redukcioni reagens) je dodato u uzorak. Dobijena smeša je vrtložna i inkubirana 20 minuta na sobnoj temperaturi. Nakon toga, 10 μL 15% NH4HCO3 (w/v) je uveden radi neutraliziranja pH otapala. Rastvor je osušen pod N2 protoka, resuspendiran u 50 μL 40:40:20 (metanol/acetonitril/voda) rastvarača i držan na 4°C u autosampleru.

Uzorci su analizirani pomoću Q Exactive Plus masenog spektrometra spojenog sa Vanquish UHPLC sistemom (Thermo Fisher Scientific). Odvajanje LC-a postignuto je pomoću XBridge BEH Amid kolone (2,1 mm × 150 mm, veličina čestica 2,5 µm, veličina pora 130-Å Waters, Milford, MA, SAD) uz korištenje gradijenta otapala A (20 mM amonijevog acetata + 20 mM amonijevog hidroksida u 95: 5 voda/acetonitril [pH 9,45]) i otapala B (acetonitril). Brzina protoka je bila 150 μl/min. Gradijent je bio 0 min, 90% B 2 min, 90% B 5 min, 50% B 10 min, 0% B 13,5 min, 0% B 15 min, 90% B 20 min, 90% B. Temperatura kolone je bila 25°C, a volumen ubrizgavanja bio je 10 μL. Parametri masenog spektrometra su mod pozitivnih iona, rezolucija 140.000 pri m/z 200, raspon skeniranja m/z 290–650, AGC meta 3E6, maksimalno vrijeme ubrizgavanja 200 ms. Kvantifikacija koncentracija GSH u uzorcima postignuta je poređenjem površina pikova glutationa sa onima 13 C-GSH. Podaci su analizirani pomoću softvera MAVEN [80].

Konkurencija

Da bismo kvantificirali više replikacija konkurencije pri više omjera početnih sojeva, koristili smo sistem kokulture da oponašamo okruženje ograničeno lizinom, posebno zato što su slične mutacije u kokulturi i monokulturi limom ograničene kemostate značile da su okruženja slična. Da bi se to postiglo, WY1340 (soj koji zahtijeva purine/oslobađanje lizina u pozadini RM11) je uzgajan do eksponencijalne faze preko noći u SD + 134 μM adenina, ispran 3 puta sa SD da bi se uklonio adenin i gladovao 24 sata da bi se iscrpio vakuol skladištenje. Tokom ovog gladovanja, WY2072/2073 (BFP met10-razvijeni klonovi) i WY2429 (mCherry MET10(evoluirani klon) uzgajani su preko noći u SD + 134 μM metioninu do eksponencijalne faze i isprani 3 puta sa SD da bi se uklonio višak metionina i lizina. I WY2072/3 i WY2429 pretjerano proizvode i oslobađaju hipoksantin koji može podržati rast partnerskog soja WY1340. Zatim su se WY2072/3 i WY2429 miješali u omjerima 1: 100, 1:10, 1: 1 i 10: 1 do konačne OD600 od 0,1. Ova mješavina populacija je zatim dodana 1:1 sa WY1340 konačnom OD600 od 0,03. To se smatralo generacijom 0. Populacije su praćene rastom mjerenjem optičke gustoće kroz vrijeme i povremeno se razrjeđivale natrag do OD600 0,03 (OD600 nikada nije bila veća od 0,45 kako bi se osiguralo da dodatni metaboliti iz SD -a nisu ograničavali). OD600 podaci su korišteni za pozadinsko izračunavanje ukupnih generacija u eksperimentu. Povremeno je uzorkovano 100 μL kulture za protočnu citometriju da bi se pratili omjeri soja. Eksperimenti su izvođeni dok se omjer naprezanja nije stabilizirao.

Test autofagije

Aktivnosti autofagije mjerene su pomoću GFP-Atg8 testa cijepanja [28]. Sojevi kvasca sa ura3 brisanje u lys − i lysmet17 -pozadina je generirana ukrštanjem i transformirana s GFP-Atg8 plazmidom (Addgene 49425 Watertown, MA, USA) za generiranje 2 soja korištenih u testovima autofagije-WY2520 (lys -) i WY2521 (lysorgS − ). Ovaj plazmid eksprimira ATG8 sa N-terminalnom GFP oznakom ispod endogenog promotora u vektoru pRS416 sa URA3 marker odabira [81]. Za svaki eksperiment, WY2520 i WY2521 su prošarani na pločama SC-Ura [74] iz zamrznutih zaliha, a zasićene noći uzgajane su iz pojedinačnih kolonija u mediju SC-Ura. Kulture zapremine 25–50 mL inokulirane su noću u SD + 164 μM lizina (WY2520) ili SD + 164 μM lizina + 134 μM GSH (WY2521) u čunjastim tikvicama i uzgajane 18–20 sati na 30 ° C do željena gustina ćelija. U skladu s objavljenim protokolima, početna ispitivanja imala su za cilj početni OD od gladovanja od 0,7–1,0. Međutim, primijetili smo da bi velike gustoće stanica mogle rezultirati većim cijepanjem GFP-Atg8 čak i u ćelijama bez zvjezdice. Tako je u sljedećim ispitivanjima izgladnjivanje započelo na OD u rasponu od 0,2-0,6. Ćelije su granulirane u sokolovim epruvetama od 50 ml i isprane tri puta u sterilnoj mililitskoj vodi. Nakon ispiranja, ćelije su resuspendovane u medijumu za izgladnjivanje po izboru (vidi detalje ispod) u fabrički čistim epruvetama pri OD od 0,1-0,2. Za uvjete u kojima ćelije nisu zaustavile rast nakon izgladnjivanja (prvenstveno izgladnjivanje sumpora), kulture su se povremeno razrjeđivale kako bi se smanjio utjecaj ograničenja sekundarnih nutrijenata uzrokovanih velikom gustoćom ćelija. Za analizu vremenskog tijeka, gladovanje je provedeno u kulturama od 10 mL u epruvetama od 18 mm, a 2 mL kulture je povučeno na analizu 24, 48 i 72 sata od početka gladovanja. Za testove sa uzorkovanjem u jednoj vremenskoj tački, gladovanje je sprovedeno u kulturama od 3 mL u epruvetama od 13 mm. lys - ćelije su gladovale 4 ili 8 sati, sa uporednim rezultatima za oba tretmana. lysorgS -ćelije su gladovale 72 sata nakon što je analiza vremenskog toka pokazala da je utjecaj gladovanja organosumpora bio vidljiv tek nakon 48 sati u testu cijepanja GFP-Atg8.

Ovdje su opisani mediji za izgladnjivanje za različite tretmane. Za lys -u ćelijama, gladovanje lizinom je izvršeno u SD medijumu. Izgladnjivanje azota je izvršeno u SD-N medijumu ili dopunjeno sa 164 μM lizina (samo gladovanje azotom) ili mu je nedostajalo (dvostruko izgladnjivanje za lizin i azot). Za lysorgS - ćelije, dvostruko izgladnjivanje lizina i organosumpora izvedeno je u SD mediju, gladovanje lizinom u SD + 134 μM GSH, a izgladnjivanje organosumpora u SD + 164 μM lizina.

Priprema uzorka izvedena je kako je predloženo u [82] s manjim izmjenama. Ćelije iz 2-4 ml kulture su peletirane u epruveti za mikrocentrifugu na 5000 × g 3 minute. Ćelijske pelete su brzo zamrznute u tekućem dušiku i pohranjene na -20°C sve dok svi uzorci nisu sakupljeni za eksperiment. Za lizu ćelija, pelete su resuspendovane u 1 mL ledeno hladne 10% trihlorosirćetne kiseline i ostavljene da stoje u hladnom metalnom bloku na ledu 30-40 minuta. Proteini su peletirani na 16.000 × g 1 minut na 4°C. Pelete su resuspendirane u 1 mL hladnog acetona vorteksiranjem i sonikacijom u kupki i ponovo peletirane centrifugiranjem. Ispiranje acetonom je ponovljeno jednom i peleti su ostavljeni da se osuše na zraku 5 minuta prije resuspendiranja u SDS-PAGE puferu za uzorak (0,1 M Tris-HCl [pH 7,5], 2% w/v SDS, 10% v/v glicerola, 20 mM DTT). Na osnovu OD izmjerenog u vrijeme prikupljanja uzorka, volumen pufera za uzorak prilagođen je tako da se postignu usporedive ćelije/μL u svakom uzorku. Staklene perle oprane kiselinom (425–600 μm Sigma G8771 Sigma-Aldrich, St. Louis, MO, USA) dodane su u svaku epruvetu, otprilike ekvivalentnu polovini volumena uzorka, a pelet je resuspendiran kucanjem kuglica 35 sekundi. Nakon centrifugiranja 20 minuta kako bi se pjeni omogućilo taloženje, uzorci su zagrijavani u metalnom bloku na 95 ° C 10 minuta. Nakon 3-minutnog centrifugiranja na 5000 × g, uzorci su pušteni na 12,5% akrilamidnom gelu 50 minuta pri konstantnoj struji od 30 mA. Trake su prebačene na 0,2-μm PVDF membranu (Bio-Rad Trans-blot 162–0184) koristeći protokol mokrog transfera pri konstantnom naponu od 60 V tokom 2 sata u hladnoj prostoriji. Za imunobloting, membrana je inkubirana preko noći na 4 ° C s anti-GFP monoklonalnom primarnom (JL-8 Clontech 632381 Clontech, Takara Bio, Mountain View, CA, SAD) u razrjeđenju 1: 5.000, nakon čega slijedi 45-minutna soba temperaturna inkubacija sa sekundarnim anti-mišem konjugiranim s hrenom-peroksidazom (GE Healthcare Lifesciences [sada poznat kao Cytiva] Marlborough, MA, SAD) u razrjeđenju 1: 10.000. Antitijela su detektirana korištenjem SuperSignal West Dura hemiluminiscentnog supstrata (Thermo Fisher Scientific). Unaprijed instalirani dodatak Gel Analyzer na ImageJ korišten je za kvantifikaciju bendova.


Funkcije urinarnog sistema


Mokraćni sistem proizvodi urin i odvodi ga van tijela.Kako bubrezi proizvode urin, oni obavljaju četiri funkcije: izlučivanje metaboličkog otpada, održavanje ravnoteže vode i soli, održavanje kiselo-bazne ravnoteže i lučenje hormona.

Izlučivanje metaboličkog otpada
Bubrezi izlučuju metabolički otpad, posebno dušični otpad. Urea je primarni dušikov krajnji proizvod metabolizma u ljudima, ali ljudi izlučuju i nešto amonijaka, kreatinina i mokraćne kiseline. Urea je nusproizvod metabolizma aminokiselina. Razgradnjom aminokiselina u jetri oslobađa se amonijak, koji jetra kombinuje s ugljičnim dioksidom kako bi proizvela ureu. Amonijak je vrlo otrovan za ćelije, ali je urea mnogo manje toksična. Budući da je manje toksičan, potrebno je manje vode za izlučivanje uree. Kreatin fosfat je visokoenergetska molekula fosfata u mišićima. Metabolički raspad kreatin fosfata rezultira kreatinin. Razgradnja nukleotida, poput onih koji sadrže adenin i timin, proizvodi mokraćne kiseline. Mokraćna kiselina je prilično netopiva. Ako je u krvi prisutno previše mokraćne kiseline, formiraju se kristali koji se talože. Kristali mokraćne kiseline ponekad se skupljaju u zglobovima, stvarajući bolnu bolest tzv giht.

Održavanje ravnoteže vode i soli
Osnovna funkcija bubrega je održavanje odgovarajuće ravnoteže vode i soli u krvi. Kao što ćemo vidjeti, volumen krvi je blisko povezan sa ravnotežom soli u tijelu. Kao što znate, soli, poput NaCl, imaju sposobnost izazivanja osmoze, difuzije vode-u ovom slučaju, u krv. Što više soli ima u krvi, to je veći volumen krvi i veći je krvni pritisak. Na taj način bubrezi su uključeni u regulaciju krvnog tlaka. Bubrezi također održavaju odgovarajuću razinu drugih iona (elektrolita), poput iona kalija (K +), bikarbonatnih iona (HCO 3 -) i kalcijevih iona (Ca 2 +), u krvi.

Bubrezi
The bubrezi su upareni organi koji se nalaze blizu donjeg dijela leđa u lumbalnoj regiji s obje strane kičmenog stuba. Leže u udubljenjima uz duboke mišiće leđa ispod peritoneuma, gdje dobivaju određenu zaštitu iz donjeg rebra. Svaki bubreg obično drži vezivno tkivo, nazvano bubrežna fascija. Masa masnog tkiva lijepi se za svaki bubreg. Oštar udarac u leđa može pomaknuti bubreg, što se tada naziva a plutajući bubreg. Bubrezi su u obliku pasulja i crvenkasto-smeđe boje. Organi veličine šake prekriveni su čvrstom kapsulom od vlaknastog vezivnog tkiva, zvanom bubrežna kapsula. Konkavna strana bubrega ima udubljenje zvano hilum gdje a bubrežna arterija ulazi i a bubrežna vena i ureter izlazi iz bubrega.

Ureteri
The ureteri, koje se protežu od bubrega do mokraćnog mjehura, male su, mišićave cijevi duge oko 25 cm i prečnika 5 mm. Svaki se spušta iza parietalnog peritoneuma, od hiluma bubrega, kako bi ušao u mjehur straga na donjoj površini. Zid uretera ima tri sloja. Unutrašnji sloj je sluznica (sluznica), srednji sloj se sastoji od glatkih mišića, a vanjski sloj je vlaknasti omotač vezivnog tkiva. Peristaltičke kontrakcije uzrokuju da urin uđe u mjehur čak i ako osoba leži. Urin ulazi u mjehur u mlazovima koji se javljaju brzinom od jedan do pet u minuti.

Urinarni mjehur
The mokraćna bešika nalazi se u zdjeličnoj šupljini, ispod parietalnog peritoneuma i neposredno iza stidne simfize. Kod muškaraca, to je direktno ispred rektuma kod žena, to je ispred vagine i inferiorno od materice. Njegova funkcija je skladištenje urina sve dok se ne izbaci iz tijela. Mjehur ima tri otvora-dva za uretere i jedan za mokraćnu cijev koja ispušta mjehur. The trigone je glatka trokutasta oblast na dnu bešike koju ocrtavaju ova tri otvora (Sl. 16.2) . Zajedno, mišićni slojevi zida mokraćne bešike nazivaju se detrusor mišića. Zid sadrži srednji sloj kružnih vlakana i dva sloja uzdužnih mišića te se može proširiti. Prijelazni epitel sluznice postaje tanja, a nabore u sluznici tzv rugae nestaju kako se bešika povećava. Mjehur ima i druge značajke koje mu omogućuju zadržavanje urina. Nakon što urin uđe u mokraćni mjehur iz mokraćovoda, mali nabori sluznice mjehura djeluju poput ventila za sprječavanje protoka unatrag. Dva sfinktera u neposrednoj blizini nalaze se na mjestu gdje uretra izlazi iz mjehura. Unutrašnji sfinkter javlja se oko otvora prema uretri. Lošiji od unutrašnjeg sfinktera, vanjski sfinkter se sastoji od skeletnih mišića koji se mogu dobrovoljno kontrolirati.

Uretra
The uretra je mala cijev koja se proteže od mokraćnog mjehura do vanjskog otvora. Uretra je različite dužine kod žena nego kod muškaraca. U ženki, uretra je dugačka samo oko 4 cm. Kratka duljina ženske uretre olakšava bakterijsku invaziju i pomaže objasniti zašto su ženke sklonije infekcijama urinarnog trakta od muškaraca. Kod muškaraca, mokraćna cijev je u prosjeku 20 cm kada je penis mlitav (mlohav, neerektan). Kako mokraćna cijev napušta muški mokraćni mjehur, ona je okružena prostatom. Kod starijih muškaraca, povećanje prostate može ograničiti mokrenje. Hirurški zahvat obično može ispraviti stanje i vratiti normalan protok urina. Kod žena reproduktivni i mokraćni sistem nisu povezani. Kod muškaraca, mokraćna cijev prenosi urin tijekom mokrenja, a spermu tijekom ejakulacije. Ova dvostruka funkcija uretre kod muškaraca ne mijenja put urina.

Mokrenje
Kada se mokraćna bešika napuni do oko 250 ml urinom, receptori za istezanje šalju senzorne nervne impulse u kičmenu moždinu. Nakon toga, impulsi motornih živaca iz leđne moždine uzrokuju kontrakciju mokraćnog mjehura i opuštanje sfinktera tako da se mokrenje, tzv. mokrenje, je moguće (Sl. 16.2) . U starije djece i odraslih mozak kontrolira ovaj refleks, odgađajući mokrenje do odgovarajućeg vremena.

Održavanje acidobazne ravnoteže
Bubrezi reguliraju acido-baznu ravnotežu krvi. Da bi osoba ostala zdrava, pH krvi bi trebao biti oko 7,4. Bubrezi nadziru i kontroliraju pH krvi, uglavnom izlučivanjem vodikovih jona (H+) i reapsorpcijom bikarbonatnih jona (HCO3-) po potrebi kako bi se pH krvi održao na oko 7,4. Urin obično ima pH 6 ili niži jer naša ishrana često sadrži kiselu hranu.

Lučenje hormona
Bubrezi pomažu endokrinom sistemu u lučenju hormona. Bubrezi oslobađaju renin, tvar koja dovodi do lučenja hormona aldosterona iz kore nadbubrežne žlijezde, vanjskog dijela nadbubrežnih žlijezda, koji se nalazi na vrhu bubrega. Aldosteron podstiče reapsorpciju jona natrijuma (Na+) u bubrezima. Kad god se smanji kapacitet krvi za prijenos kisika, bubrezi luče hormon eritropoetin, koji potiče proizvodnju crvenih krvnih stanica. Bubrezi također pomažu aktivirati vitamin D iz kože. Vitamin D je prekursor hormona kalcitriola, koji podstiče apsorpciju kalcijuma (Ca 2+) iz probavnog trakta.

Organi urinarnog sistema
Mokraćni sistem se sastoji od bubrega, uretera, mokraćne bešike i uretre. Slika 16.1 prikazuje ove organe i također prati putanju urina.


Strukturirana pitanja koja su radila

1. Opišite 3 načina na koje pušenje oštećuje pluća

  • Katran koji se taloži u plućima sadrži karcinogene i povećava rizik od raka pluća
  • Ugljični monoksid u dimu povećava taloženje masti, ako se u koronarnim arterijama lumen arterija sužava i smanjuje opskrba krvlju, što dovodi do srčanog udara
  • Iritanti uzrokuju kašalj. Dugotrajno nasilno kašljanje moglo bi dovesti do emfizema u kojem se alveolarni zidovi raspadaju

Količina proizvedenog plina u špricu (cm 3 )

(b) Iz rezultata u tabeli 1, sugerirajte koji bi šećer bio bolji respiratorni supstrat za kvasac.

(c) Predložite zašto postoji razlika u brzini disanja kada se kvascu u eksperimentu daju različiti šećeri.

(d) Istaknite sve anomalne podatke u rezultatima.

(e) Navedite moguću grešku u ovom eksperimentu i predložite poboljšanje ili rješenje.

(b) Glukoza. Daje veću količinu ugljičnog dioksida u odnosu na saharozu u istom vremenskom periodu, što ukazuje na to da se može brže iskoristiti.

(c) Sirovina koja se koristi za disanje je glukoza. Saharoza je disaharid i mora se prvo razgraditi u glukozu prije nego što se može koristiti u disanju. Zbog toga je brzina disanja sa saharozom niža od one sa glukozom.

(d) Očitavanje u 5 minuta za ponovljeni 1 glukoze. To je mnogo više od čitanja replike 2.

(e) Neki oslobođeni ugljični dioksid se možda neće zabilježiti jer se zrak može komprimirati, umjesto toga koristite datalogger. Ugljični dioksid je slabo topiv u vodi i može se otopiti u smjesi, umjesto toga upotrijebite indikator hidrogenkarbonata.

3. Slika 2 prikazuje učinak mliječne kiseline na količinu kisika koju crvena krvna zrnca oslobađaju u mišićne stanice koje aktivno dišu.

(a) Objasnite zašto se mliječna kiselina stvara tokom snažne mišićne aktivnosti.

(b) S obzirom na sl. 2, objasnite kako povećana koncentracija mliječne kiseline utječe na oslobađanje kisika u mišićnim stanicama.

(c) Kako tijelo uklanja mliječnu kiselinu?

(a) Tijekom snažne mišićne aktivnosti, samo aerobno disanje nije dovoljno za podmirivanje povećanih potreba za energijom. Anaerobno disanje se odvija u mišićnim ćelijama kako bi se nadopunila energija iz aerobnog disanja. Anaerobno disanje u mišićnim stanicama proizvodi mliječnu kiselinu.

(b) Kada postoji povećana koncentracija mliječne kiseline, postotak oksihemoglobina u krvi se smanjuje. To ukazuje da se više kisika oslobađa iz hemoglobina u mišićne stanice.

(c) Tijelo uklanja mliječnu kiselinu oksidacijom za proizvodnju energije ili konverzijom u glukozu u jetri.

4a. Koji su simptomi emfizema?

4b. Navedite uzrok emfizema

4a. otežano disanje, piskanje, nedostatak daha

5. Objasnite važnost svakog od sljedećeg u odnosu na njihovu funkciju disanja


Pogledajte video: Unosna reciklaža elektronskog otpada (Februar 2023).