Informacije

Na koje ostatke aminokiselina djeluje SDS?

Na koje ostatke aminokiselina djeluje SDS?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Želeo bih da znam tačno koji je mehanizam SDS-a, i voleo bih da znam na koje ostatke aminokiselina SDS deluje.

Možete li mi pomoći, molim vas?

Unaprijed hvala!


Ako govorite o natrijevom dodecil sulfatu (deterdžentu), on ima dvije glavne funkcije:

(1) Razbija sve nekovalentne veze u proteinima, tj. vodikove veze iz glavnog lanca, ili vodonične veze između ostataka koje zavise od oblika proteina.

(2) Prekriva proteine ​​negativnim nabojem što je korisno za laboratorijske tehnike kao što je elektroforeza u gelu.

Vaše pitanje glasi "na koje aminokiselinske ostatke djeluje?"Možete sa sigurnošću pretpostaviti da će SDS prekriti cijeli protein. Oko 0,1% otopine SDS -a dovoljno je za zasićenje polipetidnih lanaca proteinskih molekula s približno jednom molekulom SDS -a na dva aminokiselinska ostatka.


Učestalosti aminokiselinskih nizova u globularnim proteinskim sekvencama ukazuju na supresiju blokova uzastopnih hidrofobnih ostataka

Obrasci hidrofobnih i hidrofilnih ostataka igraju važnu ulogu u savijanju i funkcioniranju proteina. Dugi, pretežno hidrofobni nizovi od 20-22 aminokiseline svaki su povezani sa transmembranskim spiralama i korišteni su za identifikaciju takvih sekvenci. Mnogo manje pažnje posvećeno je hidrofobnim sekvencama unutar globularnih proteina. U prethodnom radu na računarskim simulacijama konkurencije između presavijanja na putu i formiranja agregata izvan puta, otkrili smo da duge sekvence uzastopnih hidrofobnih ostataka potiču agregaciju unutar modela, čak i kontrolirajući ukupni sadržaj hidrofobnosti. Ovdje izvještavamo o analizi učestalosti različitih dužina susjednih blokova hidrofobnih ostataka u bazi podataka aminokiselinskih sekvenci proteina poznate strukture. Utvrđeno je da su sekvence od tri ili više uzastopnih hidrofobnih ostataka znatno rjeđe prisutne u stvarnim globularnim proteinima nego što bi se predvidjelo da se ostaci biraju nezavisno. Rezultat može odražavati odabir naspram dugih blokova hidrofobnih ostataka unutar globularnih proteina u odnosu na ono što bi se očekivalo da hidrofobnosti ostataka budu nezavisne od onih u blizini u blizini.

Figure

Semi-log graf izmjerenih vrijednosti…

Polu-log grafikon izmjerenih vrijednosti distribucija dužine hidrofobnih blokova i očekivanih vrijednosti ...

Polu-kartagraf izmjerenih i…

Polu-log dijagram izmjerenih i očekivanih vrijednosti distribucije dužine hidrofobnih blokova za…

Poludnevni prikazi izmjerenih i…

Polu-log grafikoni izmjerenih i očekivanih vrijednosti distribucije dužine hidrofobnih blokova za…

Trakasti dijagram strukture UDP-a N -acetilglukozamin enolpiruvil transferaza kao…


  • Usluge
    • 1D i 2D gel dokumentacija i analiza
    • 2-D gel elektroforeza
    • Tečna hromatografija visokih performansi (HPLC)
    • Usluge hibridoma
    • Varenje u gelu i rastvoru
    • Izoelektrično fokusiranje (IEF)
    • MALDI analiza mase
    • Sinteza peptida
    • Sekvencioniranje proteina/peptida
    • Q Tačna tandemska masena spektrometrija (LC-MS/MS)
    • SDS-PAGE i elektroblotiranje
    • Synapt G2-Si HDMS
    • Tajfun sistem za snimanje
    • Kreirajte obrasce za podnošenje
    • Predstojeći seminari
    • Prethodni seminari
    • Priručnici
    • Vijesti
    • Dodatne informacije

    N-terminalno sekvenciranje proteina/peptida

    Primjeri zahtjeva

    Protein Facility koristi Shimadzu PPSQ-53A gradijentni proteinski sekvencer. Hemijski postupak koji koristi sekvencer proteina za određivanje aminokiselinske sekvence izveden je iz metode razgradnje koju je razvio Edman.

    U ovoj reakciji fenilizotiocijanat (PITC) reaguje sa aminokiselinskim ostatkom na amino terminusu pod baznim uslovima (obezbeđenim n-metilpiperidin/metanolom/vodom) da bi se formirao derivat feniltiokarbamila (PTC-protein). Trifluorooctena kiselina tada otcjepljuje prvu aminokiselinu kao njen derivat anilinotianolinona (ATZ-aminokiselina) i ostavlja novi amino kraj za sljedeći ciklus razgradnje. ATZ aminokiselina se zatim uklanja ekstrakcijom s N-butil kloridom i pretvara u derivat feniltiohidantoina (PTH-aminokiselina) sa 25% TFA/vodom (vidi sliku 1). Nekoliko nusproizvoda se takođe formira tokom Edmanove hemije razgradnje i prikazano je na slici 2. PTH-aminokiselina se prenosi u kolonu C-18 sa obrnutom fazom radi detekcije na 270 nm. Standardna mješavina 19 PTH-aminokiselina također se injektira u kolonu radi odvajanja (obično kao prvi ciklus sekvenciranja). Ovaj hromatogram pruža standardna vremena zadržavanja aminokiselina za poređenje sa svakim hromatogramom Edmanovog ciklusa degradacije. HPLC hromatogrami se prikupljaju korišćenjem kompjuterskog sistema za analizu podataka. Da bi se odredila aminokiselina prisutna u određenom broju ostatka, hromatogram od ostataka od interesa se uspoređuje sa hromatogramom iz prethodnog ostatka preklapanjem jedan na drugi. Iz ovoga se može odrediti aminokiselina za određeni ostatak (vidi sliku 3). Ovaj proces se uzastopno ponavlja kako bi se dobila N-terminalna sekvenca proteina/peptida.

    Dodatne informacije: PTH analiza amino kiselina, Michael W. Hunkapiller, Bilten korisnika ABI -a br. 14, 18. novembra 1985.

    Poželjno je 10-100 pmol, iako je manja količina prihvatljiva.

    I. U 30-150 mikrolitara hlapljivih otapala kao što su voda, acetonitril, propanol, octena kiselina ili mravlja kiselina. Čisti liofilizirani peptid/protein je također prihvatljiv.

    II. Na PVDF membrani (NE koristite Pall BioTrace PVDF ili iBlot sistem). Uzorak treba biti koncentriran što je više moguće na PVDF membrani (npr. 1 µg/traka). Može se koristiti nekoliko traka. Trake bi trebale biti obojene Coomassie Blue, Ponceau S ili Amido Black. Nakon bojenja/odbojavanja, umazana membrana mora se temeljito isprati dejoniziranom vodom. Cijela membrana može se nanijeti s označenim trakama ili se trake mogu izrezati i podnijeti.

    Tečni uzorci trebaju sadržavati samo jedan protein ili peptid. Puferi, SDS, soli, aminokiseline, primarni amini i drugi kontaminanti moraju biti uklonjeni iz vašeg uzorka. Ovi zagađivači utječu na Edmanovu reakciju razgradnje na instrumentu, zagađuju instrument ili utječu na otkrivanje PTH aminokiselina. Uzorci dostavljeni na PVDF (umazani od SDS-PAGE gelova) trebaju imati dobro razdvojene trake kako bi se kontaminacija svela na minimum.

    Pošto se nemodifikovani ostaci Cys ne mogu detektovati, Cys treba modifikovati pre podnošenja uzorka ako želite da identifikujete Cys. Postupci za izmjene mogu se dobiti u Institutu za proteine.

    Ako je amino terminal blokiran, protein ili peptid se ne mogu sekvencirati pomoću Edmanove razgradnje. Izvodimo procedure deblokiranja i razgovarat ćemo o opcijama s vama ako se sumnja na blokadu N-terminala

    Glikozilacija i druge modifikacije

    Glikozilovane aminokiseline i fosforilirane aminokiseline mogu rezultirati praznim ciklusima, smanjenim pikovima ili izmijenjenim vremenima zadržavanja. Neke od ovih modifikovanih aminokiselina mogu se identifikovati korišćenjem "Identifikacije modifikovanih PTH-amino kiselina u analizi sekvence proteina" Marka W. Crankshawa i Gregoryja A Granta.

    • Priprema uzorka:
      • Većina istraživača će uzorkovati svoj uzorak na SDS-PAGE gelu, a zatim elektroroblotirati na PVDF (NE koristiti Pall BioTrace PVDF), obojiti Coomassie-om i izrezati traku koja vas zanima. Morate koristiti PVDF, a ne nitrocelulozu. Više traka iz mrlje se može učitati u sekvencer.
      • Ako možete vizualizirati trake na PVDF membrani s Coomasssiejem, trebalo bi imati dovoljno materijala za sekvenciranje. Možete poslati cijelu membranu s jasno označenim trakama, a mi ćemo ih izrezati u našoj laboratoriji, ili možete izrezati trake koje vas zanimaju i poslati ih u epruvetu za mikro-centrifugu.
      • Morat ćete koristiti gotove gelove ili pustiti gel da polimerizira preko noći prije nego što pokrenete uzorak. To će pomoći u uklanjanju bilo koje N-terminalne blokade zbog nepolimeriziranog akrilamida u gelu. Koristite i visokokvalitetni metanol.
      • Uzorci se također mogu poslati u tekućem obliku ako ne sadrže soli, pufere, amine itd. i ako sadrže samo jedan protein.
      • Tečni uzorci koji sadrže pufere ili druge zagađivače mogu se očistiti pomoću ABI ProSorb uređaja.
      • Priprema uzoraka za redoslijed proteina: Vodič za pridošlice, Perkin Elmer Corporation, 1995

      Kontakt objekta

      E-mail:
      Telefon: (515) 294-3267
      Fax: (515) 294-7629


      Glikozilacija proteina

      Glikozilacija je kritična funkcija biosintetsko-sekretornog puta u endoplazmatskom retikulumu (ER) i Golgijevom aparatu. Otprilike polovica svih proteina tipično eksprimiranih u stanici prolazi ovu modifikaciju, što podrazumijeva kovalentno dodavanje ostataka šećera specifičnim aminokiselinama. Većina topivih i za membranu vezanih proteina eksprimiranih u endoplazmatskom retikulumu do određene su mjere glikozilirani, uključujući izlučene proteine, površinske receptore i ligande, te proteine ​​nastale u organelima. Osim toga, neki proteini koji se prenose iz Golgijeva u citoplazmu također su glikozilirani. Lipidi i proteoglikani se također mogu glikozilirati, značajno povećavajući broj supstrata za ovu vrstu modifikacije.

      Opseg

      Glikozilacija proteina ima više funkcija u stanici. U hitnoj medicini, glikozilacija se koristi za praćenje statusa savijanja proteina, djelujući kao mehanizam kontrole kvalitete kako bi se osiguralo da se samo pravilno savijeni proteini transportiraju do Golgija. Dijelovi šećera na rastvorljivim proteinima mogu biti vezani specifičnim receptorima u trans Golgi mreža kako bi se olakšala njihova isporuka na pravo odredište. Ovi šećeri mogu djelovati i kao ligandi za receptore na ćelijskoj površini kako bi posredovali ćelijsko vezivanje ili stimulirali puteve transdukcije signala (1). Budući da mogu biti vrlo veliki i glomazni, oligosaharidi mogu utjecati na interakcije protein-protein tako što olakšavaju ili sprječavaju proteine ​​da se vežu za srodne domene interakcije. Budući da su hidrofilne, mogu promijeniti i topljivost proteina (2).

      Distribucija

      Glikozilirani proteini (glikoproteini) nalaze se u gotovo svim živim organizmima koji su proučavani, uključujući eukariote, eubakterije i arhe (3,4). Eukarioti imaju najveći raspon organizama koji eksprimiraju glikoproteine, od jednoćelijskih do složenih višećelijskih organizama.

      Raznolikost glikoproteina

      Glikozilacija povećava raznovrsnost proteoma na nivo koji ne može da se poredi sa bilo kojom drugom posttranslacionom modifikacijom. Ćelija je u stanju da olakša ovu raznolikost, jer se gotovo svaki aspekt glikozilacije može modificirati, uključujući:

      • Glikozidna veza- mjesto vezivanja glikana (oligosaharida)
      • Sastav glikana- vrste šećera koji su povezani s određenim proteinom
      • Glikanska struktura—razgranati ili nerazgranati lanci
      • Dužina glikana- oligosaharidi kratkog ili dugog lanca

      Smatra se da je glikozilacija najsloženija posttranslacijska modifikacija zbog velikog broja uključenih enzimskih koraka (5). Molekularni događaji glikozilacije uključuju povezivanje monosaharida zajedno, prijenos šećera s jednog supstrata na drugi i rezanje šećera iz glikanske strukture. Za razliku od drugih ćelijskih procesa, poput transkripcije ili translacije, glikozilacija nije šablonska, pa se svi ovi koraci ne moraju nužno odvijati tijekom svakog događaja glikozilacije. Umjesto da koriste šablone, ćelije se oslanjaju na mnoštvo enzima koji dodaju ili uklanjaju šećere iz jedne molekule u drugu kako bi generirali različite glikoproteine ​​koji se vide u datoj ćeliji. Iako može izgledati kaotično zbog svih uključenih enzima, različiti mehanizmi glikozilacije su visoko uređene, postupne reakcije u kojima pojedinačna aktivnost enzima ovisi o završetku prethodne enzimske reakcije. Budući da aktivnost enzima varira ovisno o tipu ćelije i unutarstaničnom odjeljku, stanice mogu sintetizirati glikoproteine ​​koji se po strukturi glikana razlikuju od drugih stanica (5).

      Enzimi koji prenose mono- ili oligosaharide iz molekula donora do rastućih oligosaharidnih lanaca ili proteina nazivaju se glikoziltransferaze (Gtfs). Svaki Gtf ima specifičnost za povezivanje određenog šećera od donatora (šećerni nukleotid ili dolihol) sa supstratom i djeluje neovisno o drugim Gtf -ovima. Ovi enzimi su širokog opsega, jer su glikozidne veze otkrivene na gotovo svakoj funkcionalnoj grupi proteina, a pokazalo se da glikozilacija u određenoj mjeri uključuje većinu uobičajenih monosaharida (6).

      Glikozidaze kataliziraju hidrolizu glikozidnih veza za uklanjanje šećera iz proteina. Ovi enzimi su kritični za obradu glikana u ER i Golgi, a svaki enzim pokazuje specifičnost za uklanjanje određenog šećera (npr. Manozidaze).

      Vrste glikozilacije

      Glikopeptidne veze mogu se kategorizirati u specifične grupe na osnovu prirode veze šećer-peptid i vezanih oligosaharida, uključujući N-, O- i C-vezanu glikozilaciju, glipijaciju i fosfoglikozilaciju. Budući da su N- i O-glikozilacija i gpilacija najčešće otkriveni tipovi glikozilacije, u ovom će se članku veći naglasak staviti na ove modifikacije.

      Vrste glikozilacije
      N-povezanGlikan se veže za amino grupu asparagina u ER
      O-vezanoMonosaharidi se vežu za hidroksilnu grupu serina ili treonina u ER, Golgijevom, citosolu i jezgri
      GlypiationGlikansko jezgro povezuje fosfolipid i protein
      C-vezanoManoza se veže za indolni prsten triptofana
      FosfoglikozilacijaGlikan se vezuje za serin preko fosfodiestarske veze

      Proteini nisu ograničeni na određenu vrstu glikozilacije. Zaista, proteini su često glikozilirani na više mjesta s različitim glikozidnim vezama, što ovisi o više faktora, uključujući i one opisane u nastavku.

      1. Dostupnost enzima

      Glikozilacija se kontrolira premeštanjem proteina u područja s različitim koncentracijama enzima, a stanica sekvestrira enzime u specifične odjeljke kako bi regulirala njihovu aktivnost. Na primjer, nakon što je protein N-glikoziliran u ER-u, dolazi do postupne obrade glikana prometom proteina u različite Golgijeve cisterne koje sadrže visoke koncentracije specifičnih Gtfs i glikozidaza.

      2. Aminokiselinska sekvenca

      Osim zahtjeva za odgovarajućom aminokiselinom (npr. Asn za N-vezane Ser/Thr za O-vezane), mnogi enzimi imaju konsenzusne sekvence ili motive koji omogućuju stvaranje glikozidne veze (6).

      3. Konformacija proteina (dostupnost)

      Kako se proteini sintetiziraju, oni se počinju savijati u svoju sekundarnu strukturu koja se rađa, što može učiniti određene aminokiseline nedostupnima za vezivanje glikozida. Prema tome, ciljne aminokiseline moraju biti konformacijsko dostupne da bi došlo do glikozilacije.


      Diskusija

      Naši rezultati snažno sugeriraju da će katarini - svi majmuni i svi majmuni Afrike i Azije vjerovatno biti osjetljivi na infekciju SARS-CoV-2. Postoji velika konzervacija u proteinskoj sekvenci ciljnog receptora, ACE2, uključujući uniformnost na svim identificiranim i testiranim glavnim mjestima vezanja. Zaista, čak i među 21 ostatkom identifikovanim u našoj punoj listi potencijalnih tačaka vezivanja, katarine su nepromenljive (dopunska tabela 1 i dodatna slika S2). U skladu s našim rezultatima, studije infekcije pokazuju da rezus majmuni (Macaca mulatta), dugorepi makaki (M. fascicularis), i zavjese (Chlorocebus sabaeus) dozvoljavaju infekciju SARS-CoV-2 i razvijaju simptome poput COVID-19 11,12,14,15,16. Naši rezultati zasnovani na modeliranju proteina nude potencijalno bolje vijesti za majmune u Americi (platirrini). Postoje tri razlike u aminokiselinskim ostacima između platirina i katarina, a dvije od njih, H41Y i E42Q, pokazuju snažne dokaze da su utjecajne promjene. Ove promjene aminokiselina su modelirane tako da smanjuju afinitet vezivanja između SARS-CoV-2 i ACE2 za oko. 400 puta. Nedavna klinička analiza osipanja virusa, viremije i histopatologije kod katara (makaka) u odnosu na platirrinu (marmoset, Callithrix jacchus) odgovori na cijepljenje s SARS-CoV-2, pokazuju mnogo ozbiljniju manifestaciju simptoma bolesti u prethodnom, što snažno podupire naše rezultate 16. Slična smanjena osjetljivost predviđa se za tarsiere, te dva od pet lemura i lorisoida (strepsirrine). Ono što zabrinjava je to što su tri analizirana lemura koji se protežu od divergentnih loza-Coquerelova sifaka, aye-aye i plavooki crni lemur-sličniji katarinima na važnim mjestima vezivanja, uključujući i varijantu visokorizičnih ostataka na lokacija 41, te se kao takva također predviđa da će biti osjetljiva. Ipak, ovo su samo predviđeni rezultati zasnovani na aminokiselinskim ostacima i modelima interakcije protein -protein. Pozivamo na krajnji oprez u korištenju naših analiza kao osnove za relaksirajuću politiku u vezi sa zaštitom platyrhines-a, tarsiers-a ili bilo kojeg strepsirhine-a. Eksperimentalna procjena interakcija sintetičkih proteina sada se može izvesti u laboratoriji, npr. 41, i treba tražiti potvrdu naših predviđanja modela prije nego što se donesu čvrsti zaključci.

      Čini se da novi dokazi u eksperimentalnim modelima sisavaca podupiru naše rezultate. Svi psi, tvor, svinje i mačke pokazali su određenu osjetljivost na SARS-CoV-2, ali su pokazali varijacije u težini i prezentaciji bolesti, uključujući istraživanja 39,42. Zamjene na mjestima vezivanja mogu barem djelomično zaštititi od COVID-19 kod ovih sisara. Na primjer, dosadašnji ograničeni eksperimentalni dokazi upućuju na to da iako mačke - koje imaju isti ostatak kao i ljudi na mjestu 34 - nisu izrazito simptomatične, one predstavljaju plućne lezije, dok psi - koji imaju zamjenu na ovom mjestu - nemaju 39. Aminokiselinski ostatak na mjestu 24 razlikuje se od primata u svim drugim ispitivanim vrstama sisavaca. Međutim, naši modeli sugeriraju da varijantni ostaci mogu dati relativno mala smanjenja afiniteta vezivanja. Drugi izvori varijacija mogu utjecati na stabilnost proteina ACE2 34. Naši rezultati su također u skladu s prethodnim izvještajima koji ACE2 genetska raznolikost je veća kod šišmiša od one koja je primijećena među sisavcima osjetljivim na viruse tipa SARS-CoV. Predloženo je da ova varijacija ukazuje na to da vrste šišmiša mogu djelovati kao rezervoar virusa SARS-CoV ili njihovih predaka 38. Zanimljivo je da sve vrste šišmiša osim 2 koje smo pregledali imaju navodno zaštitnu varijantu, H41. Osim toga, rezultati naše analize codeml podružnica podržavaju prethodne nalaze ACE2 kod slepih miševa koji su pod pozitivnom selekcijom, uključujući mjesta unutar domene vezivanja SARS-CoV i SARS-CoV-2 43 , što može biti dokaz koevolucije virusa domaćina. Lokacije koje pokazuju dokaze o pozitivnoj selekciji unutar Katarine ACE2 sekvence nisu bile na poznatim mestima vezivanja CoV ili blizu njih (Tabela 3 i Slika 1).Dva (ostaci 653, 658) spadaju u mjesto cijepanja (ostaci 652-659) koje koristi sheddase ADAM17, za koju se zna da je u interakciji sa ACE2 44 . Međutim, nijedan od ostataka koji se odabiru nisu aminokiseline na koje cilja ADAM17 45, ostavljajući funkcionalni značaj evolucije na ovim mjestima neizvjesnim. Potrebne su daljnje kliničke i laboratorijske studije kako bi se u potpunosti razumjela dinamika infekcije.

      Postoji niz važnih upozorenja za naše istraživanje. Prvo, sva naša predviđanja temelje se na tumačenjima gena i rezultirajućim aminokiselinskim sekvencama, a ne na direktnoj procjeni individualnih odgovora na induciranu infekciju. Ipak, cjelokupni obrazac naših rezultata potvrđuju studije infekcije na nekoliko vrsta koje se koriste kao biomedicinski modeli. Dosad su sve vrste katara testirane studijama infekcije, uključujući rezus makake, dugorepe makake i majmune 7,16,46 pokazale simptome slične COVID-19 kao odgovor na infekciju, uključujući velike plućne i druge lezije organa 16 i citokinske oluje 12. Nasuprot tome, marmozeti nisu pokazivale glavne simptome kao odgovor na infekciju 16 . Iako ovi rezultati podržavaju i potvrđuju naše nalaze zasnovane na interpretaciji ACE2 sekvence, broj vrsta primata koje mogu i koje će biti testirane direktno studijama infekcije bit će ograničen na samo nekoliko. Naša studija poboljšava ovu sliku, dozvoljavajući da se naprave zaključci o zračenju primata, podržano objavljenim studijama infekcije na nekoliko ciljnih vrsta modela. Neki od naših rezultata, poput jednoobraznog očuvanja ACE2 Vezna mjesta među katarinima, potkrijepljena dokazano visokom osjetljivošću ljudi i drugih katarina na SARS-CoV-2, trebala bi dati dobar stupanj povjerenja u visoke razine rizika. S obzirom na identične ostatke ljudi na drugim majmunima i majmunima u Aziji i Africi na ciljnim mjestima, čini se malo vjerojatnim da se ACE2 receptor i proteini SARS-CoV-2 ne bi lako vezali. Naši rezultati za druge taksone ovise o modeliranju, pa ih treba tretirati opreznije. Ovo uključuje sva tumačenja osjetljivosti platirhina i strepsirrhina, gdje su učinci razlika ostataka na afinitete vezanja procijenjeni na osnovu modeliranja interakcije protein -protein. Još jedno upozorenje je da smo modelirali samo interakcije na mjestima vezanja, a ne i predviđanja na temelju varijacije pune sekvence ostataka. Ostaci koji nisu u direktnom kontaktu mogu i dalje uticati na alosterično vezivanje. Drugi faktori, uključujući proteaze neophodne za ulazak virusa i druge virusne mete, također mogu utjecati na osjetljivost na bolesti i reakcije 34. Općenito, ako se pridržavamo principa predostrožnosti, onda bi naše rezultate koji ističu veće rizike za neke vrste trebalo shvatiti s većom ozbiljnošću od naših rezultata koji predviđaju potencijalno niže rizike za druge. Drugo ograničenje naše studije je da smo pogledali samo 29 vrsta primata, iako sa širokim taksonomskim opsegom. Analiza dodatnih vrsta je važna, posebno među vrstama strepsirrine, gdje je naš obuhvat relativno mali. Konkretno, ostaci se preklapaju na važnim mjestima vezivanja u nizovima Coquerelove sifake, aye-aye i plavookog crnog lemura s onima katara, ukazuje na to da su mnogi lemuri vrlo ranjivi i naglašavamo potrebu za procjenom šire raznolikosti vrsta lemura. Nadalje, ispitujemo samo jednu jedinku po vrsti, i treba uzeti u obzir intraspecifične varijacije među populacijama, međutim, studije o intraspecifičnim ACE2 varijacijama kod ljudi i majmuna sugeriraju da su ACE2 varijante niske učestalosti 47,48,49. Konačno, također je važno zapamtiti da naša studija procjenjuje samo potencijal za početno vezivanje virusa za ciljno mjesto. Nizvodne posljedice infekcije mogu se drastično razlikovati ovisno o vrstama specifičnim proteazama, genomskim varijantama, metabolizmu i odgovorima imunološkog sistema 50,51. Kod ljudi, razvoj COVID-19 može dovesti do proinflamatorne citokinske oluje hiperinflamacije, što može dovesti do nekih od ozbiljnijih posljedica infekcije 32,52. Ipak, iz stotina hiljada smrtnih slučajeva i globalnog zatvaranja evidentno je da su ljudi vrlo osjetljivi na infekciju SARS-CoV-2, a naši rezultati ukazuju na to da su svi majmuni i majmuni u Africi i Aziji podložni.

      Mnoge ugrožene vrste primata sada se nalaze samo u vrlo malim populacijama 53. Na primjer, vjeruje se da je ostalo samo oko 1000 planinskih gorila u cijelom njihovom rasponu 54. S tako malom populacijom, uvođenje nove visoko zarazne bolesti izaziva ozbiljnu zabrinutost. Ponovno otvaranje pristupa naviknutim grupama majmuna u turističke svrhe, što bi moglo biti kritično za lokalnu ekonomiju 55, može biti opterećeno problemima. Najbolje prakse IUCN-a preporučuju turistima da ostanu najmanje 7 metara udaljeni od velikih majmuna 56 , ali u praksi se gotovo svi turisti približavaju mnogo bliže od ovoga - na primjer, prosječna udaljenost koju turisti prolaze od planinskih gorila u nacionalnom parku Bwindi Impenetrable u Ugandi je samo 2,76 m 57 . Svi dionici mogu zahtijevati zajedničke napore kako bi pokušali izbjeći unošenje SARS-CoV-2 u populaciju divljih primata 10. Nedavne mjere koje je IUCN predložio za istraživače i njegovatelje populacija velikih majmuna uključuju: osiguravanje da svi pojedinci nose čistu odjeću i dezinficiranu obuću, osiguravanje objekata za pranje ruku koji zahtijevaju da hiruršku masku za lice nose svi koji se nalaze na udaljenosti većoj od 10 m od velikih majmuna, osiguravajući da osobe koje treba da kašlju ili kihaju idealno bi napustile to područje, ili barem kašljale/kihale do lakata, uvodeći 14-dnevni karantin za sve ljude koji dolaze u područja velikih majmuna i koji će im često dolaziti u blizinu 17 . Također treba slijediti IUCN -ove ‘Smjernice najbolje prakse za praćenje zdravlja i kontrolu bolesti u populaciji velikih majmuna’ 58.

      Naši rezultati sugeriraju da su desetine neljudskih vrsta primata, uključujući sve naše najbliže rođake, vjerovatno vrlo osjetljive na infekciju SARS-CoV-2 i ranjive na njene posljedice. Možda će biti potrebne velike radnje kako bi se ograničila izloženost mnogih populacija divljih primata ljudima. To će vjerojatno zahtijevati koordiniran doprinos svih zainteresiranih strana, uključujući lokalne zajednice, međunarodne i nacionalne vladine agencije, nevladine organizacije za očuvanje i razvoj te akademike i istraživače. Iako je fokus mnogih u ovom trenutku s pravom na ublažavanju humanitarnog razaranja COVID-19, također imamo dužnost osigurati da naši najbliži živi rođaci ne pate od razornih infekcija i daljnjeg opadanja broja stanovnika kao odgovor na još jednu uzrokovanu ljudima katastrofa.


      MATERIJALI I METODE

      Strukturno poravnanje

      Katalitička domena CCP3 modelirana je uz pomoć RaptorX servera (Källberg et al., 2012.) i koristeći kao predloške dostupne strukture tri CCP -a iz P. aeruginosa (PDB 4a37 Otero et al., 2012), B. mallei (PDB 3k2k) i S. denitrificans (PDB 3l2n). Ramachandran grafikoni izvedeni su za predložene modele radi provjere ispravne stereokemije ostataka, a lokalna i ukupna kvaliteta modela provjerena je pomoću Verify3D (Bowie et al., 1990 Luthy et al., 1992) i Prosa-web (Sippl, 1993, Wiederstein i Sippl, 2007). Arg na poziciji 255 podržan je poravnavanjem sekvence zasnovanim na strukturi koje je izveo RaptorX, I-TASSER (Zhang, 2008 Roy et al., 2010.), GalaxyWEB (Ko et al., 2012), i PDBsum (Laskowski, 2001 neobjavljeni podaci).

      Uzgoj ćelija, transfekcija i imunoblotiranje

      Adherentne HEK293T ćelije su održavane u standardnim uslovima i transfektovane (videti Dodatnu tabelu S1 za plazmide) sa linearnim polietileniminom (PEI Polysciences, Eppelheim, Nemačka) u odnosu DNK:PEI 1:3. Ćelije su sakupljene nakon 48 h, lizirane u 100 mM Tris-HCl, pH 8, 150 mM NaCl i 0,1% NP-40 sa dodatkom 1/1000 koktela inhibitora proteaze bez EDTA Set III (Calbiochem, Darmstadt, Njemačka) , i centrifugirano 10 minuta, 15.000 × g na 4 ° C. SDS–PAGE i imunoblotiranje na nitrocelulozne membrane (EMD Millipore, Darmstadt, Njemačka) obavljeni su prema standardnim protokolima. Proteini su otkriveni korištenjem različitih primarnih antitijela (dodatna tablica S2) i vizualizirani sekundarnim antitijelima označenim peroksidom hrena, nakon čega je uslijedila kemiluminiscencija (ECL Western blot kit za otkrivanje GE Healthcare, Velizy-Villacoublay, Francuska).

      Fiksacija ćelija i imunocitohemija

      Za imunofluorescenciju, ćelije HEK293T su posijane u posude za kulturu i transficirane 24 sata nakon podmetanja, kao što je ranije opisano. Nakon 12 h, ćelije su tripsinizirane i stavljene na sterilne staklene poklopce u pločama sa šest jažica (Nunc, Villebon sur Yvette, Francuska) i inkubirane 24 sata prije fiksacije. Primijenjena je metoda fiksacije za očuvanje struktura mikrotubula (Bell i Safiejko-Mroczka, 1995.). Ukratko, ćelije su inkubirane 10 minuta na sobnoj temperaturi u 1 mM ditiobis(sukcinimidil propionat) (DSP Thermo Scientific, Rockford, IL) u Hanksovoj izbalansiranoj otopini soli, nakon čega je uslijedilo 10 minuta inkubacije sa 1 mM DSP u puferu za stabilizaciju mikrotubula. (MTSB). Ćelije su isprane 5 minuta u fiziološkom rastvoru puferisanom fosfatom (PBS) sa 0,5% Triton X-100 (Fluka, Saint-Quentin Fallavier, Francuska) u MTSB pre fiksacije sa 4% paraformaldehida (PFA) u MTBS. Nakon ovog koraka uslijedilo je 5-minutno ispiranje u PBS-u, 5 minuta u 100 mM glicina u PBS-u i konačno ispiranje u PBS-u.

      Nakon fiksacije, ćelije su isprane 5 minuta u PBS-u koji sadrži 0,1% Triton X-100 i zatim inkubirane s primarnim antitijelima u PBS-u, 0,1% Triton X-100 i 2% goveđeg serumskog albumina (Sigma-Aldrich, Villebon sur Yvette, Francuska ) 1 h na sobnoj temperaturi. Sljedeće ćelije su isprane četiri puta sa PBS i 0,1% Triton X-100, nakon čega je uslijedila 1-časovna inkubacija sa Alexa Fluor 568 protiv zeca i Alexa Fluor 350 protiv miša (Invitrogen, Saint Aubin, Francuska) u PBS i 0,1% Triton X-100. Ispiranje je izvršeno prije postavljanja pokrova sa ProLong Gold -om (Life Technologies, Saint Aubin, Francuska).

      Ekstrakcija RNK i kvantitativni PCR

      Organi su secirani miševima od 4 do 5 tjedana i odmah zamrznuti u tekućem dušiku. IMCD3 ćelije su održavane u standardnim uslovima i serum izgladnjivao 3 i 5 dana da bi se indukovala ciliogeneza. Ekstrakcija RNA izvedena je reagensom TRIzol (Life Technologies), prema uputama proizvođača. Određena je koncentracija i kvalitet RNK, a qRT-PCR je primijenjen pod standardnim uvjetima korištenjem SYBR Green Master Mix kita na ABI Prism 7900 Sequence Detection System (PerkinElmer-Cetus, Courtaboeuf, Francuska) koristeći specifične prajmere (Dopunska tabela S4).

      Potražite u bazi podataka proteine ​​koji završavaju kiselim aminokiselinskim dijelovima

      Bioinformatička potraga za proteinima koji su podložni da budu supstrati CCP izvršena je pomoću ScanProsite alata (de Castro et al., 2006.). Potraga za ukupnim kiselim proteinima izvršena je pomoću obrasca [ED](n) & gt, gdje n predstavlja broj uzastopnih kiselih ostataka na C-kraju proteina. Tražili smo dionice C-terminala od dvije i duže. Ukupan broj proteina s određenim brojem kiselih aminokiselina na C-kraju određen je iz H. sapiens, M. musculus, D. melanogaster, i C. elegans taksoni baze podataka UniProtKB/Swiss-Prot 2014_05, koristeći zadane postavke. Varijante spajanja nisu dozvoljene. Ista pretraga je ponovljena za C-terminalne repove koji sadrže samo ostatke glutamata.

      Generacija Agbl2 KO, Agbl3 KO i Agbl2/Agbl3 duplo KO miševi

      Uslovne mutirane linije miša za Agbl2 (na egzonu 9) i za Agbl3 (na eksonima 7 + 8) osnovani su na Kliničkom institutu Mouse (MCI, Illkirch, Francuska). Vektor ciljanja je konstruiran na sljedeći način. 5′ (4,5 kb za Agbl2 3.5 kb for Agbl3), 3′ (3,5 kb za CCP2 4,7 kb za CCP3) i inter-loxP (1,1 kb za Agbl2 3.0 kb for Agbl3) fragmenti su PCR amplificirani i sekvencijalno subklonirani u MCI vlasnički vektor koji sadrži LoxP mjesta i Neo kasetu okruženu ciljnim mjestima za prepoznavanje Flippase (dodatna slika S6). Linearizirani konstrukt je elektroporiran u 129S2/SvPas embrionalnim matičnim (ES) ćelijama miša. Nakon odabira, ciljani klonovi su identificirani PCR -om pomoću vanjskih prajmera i dodatno potvrđeni Southern blotom sa 5 ′ i 3 ′ vanjskim sondama. Dva pozitivna ES klona ubrizgana su u blastociste, a izvedene muške himere dale su prijenos zametne linije. Ekscizija kasete otporne na neomicin izvedena je in vivo razmnožavanjem himera sa Flp deleter linijom (C57BL/6N genetska pozadina FLP pod ACTB promotorom). Flp transgen je segregiran uzgojem prvih zametnih miševa sa C57BL/6N životinjom divljeg tipa. Za generaciju Agbl2 KO and Agbl3 KO miševi, Agbl2 i Agbl3 floksirani miševi ukrštani su s transgenim miševima koji eksprimiraju Cre rekombinazu pod kontrolom promotora citomegalovirusa.

      The Agbl2/Agbl3 dvostruko-KO miševi su potom generirani ukrštanjem jednostrukih KO miševa. Genomska DNK izolirana iz lista mišjeg repa analizirana je PCR-om.

      Miševi su genotipizirani PCR-om prema MCI protokolima korištenjem GoTag polimeraze (Promega, Charbonnieres, Francuska) i 33 ciklusa amplifikacije. Sljedeći skupovi od tri para prajmera korišteni su za definiranje genotipova.

      CCP2_Ef: CATCCTTAGCAACTCTCCCGATGCCC, CCP2_Er: GGTGGGGGTGTGTGTGAAATGGCTG

      CCP2_Lf: CCACGAGCGACCTTCCAAACCTACC, CCP2_Lr: AGCTGCCTGCTACAGCAAACGGG

      CCP2_Lf: CCACGAGCGACCTTCCAAACCTACC, CCP2_Er: GGTGGGGGTGTGTGTGAAATGGCTG

      CCP3_Ef: CCTCAAAACCACTGACCATCTAGACAGCC, CCP3_Er: GGGCTGGAGTAGACACTGTACATAAGAAAGC

      CCP3_Lf: CTGGAGTGGGACTAGTATCTTGAAGATGGG, CCP3_Lr: CCCCAGGAACTTTGACCCTTTGTGTGC

      CCP3_Lf: CTGGAGTGGGACTAGTATCTTGAAGATGGG, CCP3_Er: GGGCTGGAGTAGACACTGTACATAAGAAAGC

      Eksperimenti na životinjama

      Divlji tip C57BL/6N, Agbl2 KO, Agbl3 KO i Agbl2/Agbl3 dvostruki KO miševi bili su smješteni u uslovima bez specifičnih patogena u prostoriju za životinje Instituta Curie. Životinje su imale pristup hrani i vodi ad libitum u prostoriji za kolonije na stalnoj temperaturi (19-22 ° C) i vlažnosti (40-50%) u 12-satnim ciklusima svjetlo/mrak. Svi eksperimentalni postupci izvedeni su strogo u skladu sa smjernicama Evropske zajednice (86/609/EEC) i Francuskog nacionalnog komiteta (87/848) za njegu i korištenje laboratorijskih životinja.


      Na koji aminokiselinski ostatak djeluje SDS? - Biologija

      PONAŠANJE AMINO KISELINA NA BAZI KISELINE

      Ova stranica prikazuje šta se događa s aminokiselinama dok mijenjate pH dodavanjem kiselina ili lužina njihovim otopinama.

      Radi jednostavnosti, stranica gleda samo aminokiseline koje sadrže jedan -NH2 grupa i jedna -COOH grupa.

      Aminokiseline kao cviterioni

      Zwitterioni u jednostavnim otopinama aminokiselina

      Aminokiselina ima i bazičnu aminsku grupu i grupu kisele karboksilne kiseline.

      Postoji unutrašnji transfer jona vodonika iz -COOH grupe u -NH2 grupa da napuste ion sa negativnim i pozitivnim nabojem.

      Ovo se zove a zwitterion.

      Ovo je oblik u kojem aminokiseline postoje čak iu čvrstom stanju. Ako otopite aminokiselinu u vodi, jednostavno rješenje također sadrži ovaj ion.

      Zwitterion je spoj bez ukupnog električnog naboja, ali koji sadrži zasebne dijelove koji su pozitivno i negativno nabijeni.

      Dodavanje lužine u otopinu aminokiseline

      Ako povećate pH otopine aminokiseline dodavanjem hidroksidnih jona, vodikov ion se uklanja iz -NH3 + grupa.

      Mogli biste pokazati da aminokiselina sada postoji kao negativni ion koristeći elektroforeza.

      U svom najjednostavnijem obliku, elektroforeza se može sastojati samo od komada navlaženog filter papira na mikroskopskom predmetu s krokodilskom kopčom na svakom kraju pričvršćenom za bateriju. Kap rastvora aminokiselina stavlja se u centar papira.

      Iako je otopina aminokiselina bezbojna, njen položaj nakon nekog vremena može se utvrditi prskanjem otopinom ninhidrin. Ako se papir ostavi da se osuši, a zatim lagano zagrije, aminokiselina se pojavljuje kao obojena mrlja.

      Utvrdilo bi se da aminokiselina putuje prema anodi (pozitivnoj elektrodi).

      Dodavanje kiseline u otopinu aminokiselina

      Ako smanjite pH dodavanjem kiseline u otopinu aminokiseline, -COO - dio cwitteriona preuzima ion vodika.

      Ovaj put, tokom elektroforeze, aminokiselina bi se pomjerila prema katodi (negativna elektroda).

      Prebacivanje pH iz jedne krajnosti u drugu

      Pretpostavimo da počnete s jonom koji smo upravo proizveli u kiselim uvjetima i polako mu dodajete alkalije.

      Taj ion sadrži dva kisela vodonika - onaj u -COOH grupi i onaj u -NH3 + grupa.

      Kiseliji od njih je onaj u -COOH grupi, pa se on prvo uklanja - i vraćate se na cviterion.

      Dakle, kada dodate samo pravu količinu lužine, aminokiselina više nema neto pozitivan ili negativan naboj. To znači da se ne bi kretao ni prema katodi ni anodi tokom elektroforeze.

      pH pri kojem se javlja nedostatak kretanja tokom elektroforeze poznat je kao izoelektrična tačka aminokiseline. Ovaj pH varira od aminokiseline do aminokiseline.

      Ako nastavite dodavati hidroksidne ione, dobit ćete reakciju koju smo već vidjeli, u kojoj se vodikov ion uklanja iz -NH3 + grupa.

      Bilješka: Možda ste očekivali da će izoelektrična tačka biti na pH 7 - kada otopina nije ni kisela ni alkalna. U stvari, izoelektrična tačka za mnoge aminokiseline je oko pH 6. Objašnjenje zašto nije na pH 7 prilično je dugotrajno i gotovo sigurno prevazilazi ono što će vam trebati za nivo UK A (ili ekvivalentne vrijednosti). Ako ste zainteresirani, problem se raspravlja na dnu ove stranice.

      Možete, naravno, obrnuti cijeli proces dodavanjem kiseline u jon s kojim smo upravo završili.

      Taj ion sadrži dvije osnovne grupe - -NH2 grupa i -COO - grupa. -NH2 grupa je jača baza, pa prvo hvata ione vodika To vas opet vodi nazad u zwitterion.

      . . . i, naravno, možete nastaviti tako što ćete dodati jon vodonika u -COO - grupu.

      Zašto izoelektrična tačka aminokiseline nije na pH 7?

      Upozorenje: Ako studirate nastavni program sa sjedištem u Velikoj Britaniji, malo je vjerojatno da će vam to trebati za potrebe ispita. Uključeno je samo radi interesa - vjerovatno ga možete zanemariti. Provjerite svoj program i prethodne radove. Ako ih nemate, slijedite ovaj link kako biste saznali kako ih nabaviti.

      Kada se aminokiselina otopi u vodi, situacija je malo složenija nego što se na ovom nivou pretvaramo. Zwitterion stupa u interakciju s molekulima vode - djelujući i kao kiselina i kao baza.

      -NH3 + grupa je slaba kiselina i donira ion vodonika molekulu vode. Budući da je to samo slaba kiselina, položaj ravnoteže bit će lijevo.

      -COO - grupa je slaba baza i uzima ion vodonika iz molekula vode. Opet, ravnoteža leži lijevo.

      Kada otopite aminokiselinu u vodi, događaju se obje reakcije.

      Položaji te dvije ravnoteže nisu identični - variraju ovisno o utjecaju grupe "R". U praksi, za jednostavne aminokiseline o kojima smo govorili, položaj prve ravnoteže leži malo dalje desno od druge.

      To znači da će u otopini biti znatno više negativnih iona iz aminokiseline nego pozitivnog.

      U tim okolnostima, ako biste izvršili elektroforezu na nemodificiranoj otopini, došlo bi do blagog pomaka aminokiseline prema pozitivnoj elektrodi (anodi).

      Da biste to spriječili, morate smanjiti količinu negativnog iona tako da koncentracije dva iona budu identične. To možete učiniti dodavanjem vrlo male količine kiseline u otopinu, pomjerajući položaj prve ravnoteže dalje ulijevo.

      Obično se pH mora smanjiti na oko 6 da bi se to postiglo. Za glicin, na primjer, izoelektrična tačka je pH 6,07 za alanin, 6,11, a za serin, 5,68.

      Bilješka: Moram ponovo naglasiti da ove brojke (i argumenti) vrijede samo tamo gdje postoji samo jedan -NH2 grupa i jedna -COOH grupa u aminokiselini. Izoelektrične točke su prilično različite ako molekula sadrži drugi -NH2 ili -COOH grupa.

      Pitanja za testiranje vašeg razumijevanja

      Ako je ovo prvi set pitanja koje ste postavili, pročitajte uvodnu stranicu prije nego što počnete. Morat ćete koristiti DUGME NAZAD na vašem pretraživaču da biste se kasnije vratili ovdje.


      Aromatične aminokiseline

      Aromatične aminokiseline, triptofan, fenilalanin i tirozin mogu se napraviti počevši od dva jednostavna molekula - PEP i eritroza-4-fosfata (slika 6.145). Sve tri aromatične aminokiseline su također važni izvori hormona, neurotransmitera, pa čak i pigmenta kože melanina.

      Sinteza triptofana

      Proteogena aminokiselina sa najvećom R-grupom, triptofan je esencijalna aminokiselina koja se strukturno razlikuje po svojoj indolnoj grupi. Aminokiselina se u bakterijama i biljkama proizvodi od šikiminske kiseline ili antranilata, a u sintezi se koristi serin.

      Eritroza-4-fosfat i fosfenolpiruvat (PEP) takođe služe kao gradivni elementi triptofana. Put njegove sinteze prikazan je na slikama 6.146 do 6.148.

      Eritroza-4-fosfat i fosfoenolpiruvat (PEP) se spajaju i zatim, nakon jedne hidrolize, jedne dehidracije, jedne oksidacije i jedne redukcije, proizvod je šikimska kiselina (slika 6.147).

      Šikimska kiselina se pretvara u horizmatičnu kiselinu u tri koraka, kao što je prikazano na slici 6.147. Konačno, sinteza triptofana iz horizminske kiseline prikazana je na slici 6.148.

      Regulacija sinteze triptofana u bakterijama se odvija djelomično kroz proces koji se naziva atenuacija koji djeluje kroz trp operon. U ovom mehanizmu, nizak nivo triptofana usporava kretanje (i translaciju) ribosoma kroz operon. Ovo je posebno važno jer se transkripcija i translacija mogu pojaviti istovremeno kod bakterija. Usporavanje translacije zbog niskog nivoa triptofana omogućava inhibiciju mehanizma terminacije transkripcije. Budući da se translacija usporava samo kada je triptofana manjkavo, prijevremeni prekid transkripcije dolazi kada je triptofan u izobilju (vidi i OVDJE).

      Osim što je važan za stvaranje proteina, triptofan je važan prekursor serotonina (neurotransmitera), melatonina (hormona), niacina (vitamina) i auksina (biljnog hormona). Dva puta koja vode od triptofana do tri od ovih molekula prikazana su na slici 6.149.

      Melatonin je spoj napravljen od triptofana koji se nalazi u širokom spektru bioloških sistema, uključujući biljke, životinje, gljive i bakterije. Kod životinja djeluje kao hormon za sinhronizaciju cirkadijalnog ritma, signalizirajući početak mraka svaki dan. Utječe na vrijeme spavanja, sezonske učinke i može utjecati na krvni tlak, između ostalih fizioloških pojava. Može proći kroz stanične membrane, kao i krvno-moždanu barijeru. Melatonin je snažan antioksidans i pruža zaštitne funkcije nukleinskim kiselinama. Ponekad se koristi za liječenje poremećaja spavanja. Neki izvještaji pokazuju da djeca s autizmom imaju abnormalne puteve melatonina s niskim nivoom hormona.

      Na proizvodnju melatonina utječe plavo svjetlo i može biti povezano s poremećajima sna kod ljudi koji koriste računarske monitore nakon mraka. Kako bi se zaštitili od ovoga, dostupni su neki kompjuterski programi koji smanjuju izlaz plave svjetlosti ekrana i rsquos u večernjim satima. Dostupne su i posebne naočare koje blokiraju plavo svjetlo. Iako je melatonin povezan sa spavanjem kod nekih životinja (uključujući ljude), noćne životinje se aktiviraju povećanjem nivoa melatonina. Različite dužine dana i noći tokom godine mijenjaju proizvodnju melatonina i pružaju biološke signale godišnjih doba. Ovo je posebno važno u sezonskom obojenju i uzgojnim navikama nekih životinja. Melatonin je prisutan u trešnjama, bananama, grožđu, pirinču, žitaricama, maslinovom ulju, vinu i pivu.

      Serotonin, ili 5-hidroksitriptamin, je monoaminski neurotransmiter izveden iz triptofana. Trombociti u krvi skladište serotonin i oslobađaju ga kada se vežu za ugrušak, uzrokujući vazokonstrikciju. Serotonin igra ulogu u kognitivnim funkcijama i poboljšava pamćenje i učenje. Smatra se da serotonin doprinosi osjećaju sreće i blagostanja. Neki uobičajeni lijekovi protiv depresije, uključujući Prozac, Paxil i Zoloft, djeluju tako da moduliraju djelovanje serotonina u sinapsama.

      Niacin je poznat i kao vitamin B3 i nikotinska kiselina. Niacin se može napraviti od triptofana, a ljudi koji nemaju sposobnost apsorpcije triptofana u probavnom sistemu pokazuju simptome slične nedostatku niacina.

      Ekstremni nedostatak niacina u prehrani dovodi do bolesti poznate kao pelagra, dok su nedovoljne količine niacina u prehrani povezane s mučninom, anemijom, glavoboljom i umorom. Prehrana koja se prvenstveno sastoji od žitarica poput kukuruza može dovesti do nedostatka niacina, jer niacin u tim izvorima nije lako bioraspoloživ. Tretiranje zrna alkalijom, kao u tradicionalnoj meksičkoj praksi namakanja kukuruza u kreču, može učiniti da se niacin lakše apsorbira iz hrane.

      Niacin je povezan sa piridinom, a njegov amidni oblik je nikotinamid, važna komponenta NAD+/NADH i NADP+/NADPH. Posljednji parovi molekula bitni su kao akceptori/nositelji elektrona za većinu reakcija redukcije oksidacije stanica.

      Auksini su hormoni rasta biljaka dobiveni iz triptofana. Najvažniji od njih je indol-3-octena kiselina (slika 6.151). Auksini su uključeni u gotovo sve aspekte rasta i razvoja biljaka. Oni aktiviraju proteine, kao što su ekspanzini i različiti enzimi koji mijenjaju strukturu komponenti stanične stijenke, kako bi olabavili stanične stijenke biljke i potaknuli produženje stanica. U prisutnosti citokinina, auksini potiču diobu stanica. Auksini su također uključeni u održavanje meristema te u uzorkovanje stanica i organogenezu. Auksini su ključni za uspostavljanje korijenskih primordija, kao i za izduživanje korijenskih dlačica. Auksini igraju važnu ulogu u organiziranju ksilema i floema biljaka, a odavno je poznato da se biljno kalusno tkivo može natjerati da se diferencira u izdanke ili korijenje, ovisno o relativnim koncentracijama auksina i citokinina u mediju.

      Agrobacterium tumefaciens, bakterija koja inficira veliki broj biljaka, ubacuje vlastitu DNK, uključujući gene potrebne za sintezu biljnih hormona, u svoje ćelije domaćine. Kasnija prekomjerna proizvodnja auksina stimulira rast tumora (koji se nazivaju krunske žuči) na biljci (slika 6.153).

      Fenilalanin je esencijalna, hidrofobna aminokiselina u ljudi koja je prekursor tirozina, a budući da je tirozin prekursor nekoliko važnih kateholamina, fenilalanin je, stoga, i njihov prekursor.

      Fenilalanin je povezan s genetskom bolešću fenilketonurijom (PKU) koja nastaje zbog nemogućnosti metaboliziranja aminokiseline kod ljudi kojima nedostaje (ili nedostaje) enzim fenilalanin hidroksilaze. Ako se ne liječi, bolest može uzrokovati oštećenje mozga, pa čak i smrt, ali ako se otkrije rano, može se lako upravljati pažljivim praćenjem unosa aminokiseline u prehranu. Zbog toga se novorođenčad rutinski testira na PKU. Fenilalanin je komponenta vještačkog zaslađivača poznatog kao aspartam (Nutrasweet - Slika 6.154) i zbog toga je opasan za osobe koje pate od ovog poremećaja.

      Biosinteza fenilalanina u bakterijama preklapa se sa sintezom triptofana. Grana se javlja u korizmičkoj kiselini gdje enzim korizmat mutaza katalizira molekularno preuređenje kako bi se proizveo prefenat.

      Napad protona na prefenat dovodi do gubitka vode i ugljičnog dioksida kako bi se dobio fenilpiruvat.

      Transaminacijom fenilpiruvata nastaje fenilalanin.

      Alternativno, fenilalanin može dobiti svoju aminsku grupu u reakciji transaminacije iz alanina.

      Hidroksilacija fenilalanina aromatskom aminokiselinskom hidroksilazom (fenilalanin hidroksilazom) daje tirozin.

      Tirozin

      Budući da se tirozin proizvodi od fenilalanina, a ovaj je esencijalna aminokiselina u ljudi, nije jasno treba li tirozin klasificirati kao esencijalni ili neesencijalni. Neki ga definiraju kao uvjetno esencijalnu aminokiselinu. Drugi ga jednostavno kategoriziraju kao nebitno.

      Kao što je gore navedeno, tirozin može nastati kao rezultat hidroksilacije fenilalanina. Osim toga, biljke mogu sintetizirati tirozin oksidacijom prefenata nakon čega slijedi transaminacija nastalog 4-hidroksifenilpiruvata (slika 6.155).

      Hidroksilna grupa na tirozinu je meta fosforilacije enzimima proteina kinaze koji su uključeni u puteve transdukcije signala (slika 6.156). Kada se nalaze u membranama, ti se enzimi nazivaju receptorske tirozin kinaze i igraju važnu ulogu u kontroliranju ćelijskog ponašanja/odgovora.

      U fotosistemu II hloroplasta, tirozin, u srcu sistema, djeluje kao donor elektrona za smanjenje oksidiranog hlorofila. Vodonik iz hidroksilne grupe tirozina se gubi u procesu, što zahtijeva ponovnu redukciju pomoću četiri jezgra klastera mangana.

      Tirozin je također važan u maloj podjedinici klase I ribonukleotid reduktaza gdje stvara stabilan radikal u katalitičkom djelovanju enzima (vidi OVDJE).

      Tirozin je prekursor kateholamina, poput L-dope, dopamina, norepinefrina i epinefrina (slika 6.157). Hormoni štitnjače trijodtironin (T3) i tiroksin (T4) se također sintetiziraju iz tirozina. Kao što je prikazano na slici 6.158, ovo uključuje niz jodiranja tirozinskih bočnih lanaca proteina poznatog kao tiroglobulin. Kombinacije jodiranih tirozina stvaraju tiroksin i trijodtironin. Oni se zatim odvajaju od proteina i puštaju u krvotok.

      Oksidacija i polimerizacija tirozina uključeni su u sintezu porodice pigmenata melanina. Tirozin je uključen u sintezu najmanje dva tipa - eumelanina i feomelanina (slika 6.159).

      Drugi molekul izveden iz tirozina je benzohinon dio koenzima Q (CoQ). Ovaj put zahtijeva enzim HMG-CoA reduktazu, a budući da je ovaj enzim inhibiran statinima koji snižavaju kolesterol, CoQ može biti ograničen kod ljudi koji se liječe od visokog nivoa kolesterola.

      Dopamin

      Dopamin ima nekoliko važnih uloga u mozgu i tijelu. Član porodice kateholamina i fenetilamina, ime mu potiče od činjenice da je amin nastao uklanjanjem karboksilne grupe iz L-DOPA. Dopamin se sintetizira u mozgu i bubrezima. Također se proizvodi u biljkama, iako njegova funkcija u biljkama nije jasna. Za pretvaranje dopamina u norepinefrin (slika 6.157) potreban je vitamin C.

      Dopamin je neurotransmiter, oslobađa ga jedna živčana ćelija, a zatim putuje kroz sinapsu kako bi signalizirao susjednu živčanu ćeliju. Dopamin igra važnu ulogu u ponašanju mozga posredstvom nagrađivanja. Nagrade, poput hrane ili društvene interakcije, povećavaju nivo dopamina u mozgu, kao i droge koje stvaraju ovisnost. Drugi putevi dopamina u mozgu uključeni su u motoričku kontrolu i upravljanje otpuštanjem različitih hormona.

      Izvan nervnog sistema, dopamin je lokalni hemijski glasnik. U krvnim žilama inhibira oslobađanje norepinefrina i uzrokuje vazodilataciju. U bubrezima povećava izlučivanje natrija i izlučivanje urina. Smanjuje gastrointestinalnu pokretljivost i štiti crijevnu sluznicu u probavnom sistemu i imunološkom sistemu, smanjuje aktivnost limfocita. Učinak dopamina na gušteraču je smanjenje proizvodnje inzulina. S izuzetkom krvnih sudova, dopamin se sintetizira lokalno i ispoljava svoje djelovanje u blizini stanica koje ga oslobađaju.

      Epinefrin (koji se naziva i adrenalin) je kateholamin hemijski srodan norepinefrinu koji je hormon sa medicinskom primenom. Koristi se za liječenje anafilaksije, srčanog zastoja, sapi i, u nekim slučajevima, astme, kada drugi tretmani ne djeluju, zbog svoje sposobnosti da pogoduje bronhodilataciji.

      Epinefrin je lijek izbora za liječenje anafilaksije. Spoj se može dati inhalacijom, intravenoznom injekcijom ili potkožnom injekcijom, a djeluje preko & alpha- i & beta-adrenergičkih receptora. U tijelu ga proizvode i oslobađaju nadbubrežne žlijezde i neki neuroni.

      Fiziološki učinci epinefrina mogu uključivati ​​ubrzan rad srca, povišeni krvni tlak, rad srca, širenje zjenica, koncentraciju šećera u krvi i pojačano znojenje. Ostali fizički efekti mogu uključivati ​​drhtavicu, povećanu anksioznost i abnormalni srčani ritam.

      Norepinefrin (koji se naziva i noradrenalin) je molekul kateholamina koji djeluje kao hormon i neurotransmiter. Hemijski je sličan epinefrinu, razlikuje se samo po odsustvu metilne grupe na svom aminu. Norepinefrin proizvodi i oslobađa centralni nervni sistem (locus coeruleus mozga) i simpatički nervni sistem. Spoj se oslobađa u krvotok iz nadbubrežnih žlijezda i utječe na alfa i beta adrenergičke receptore.

      Norepinefrin je na najnižim nivoima tokom sna, a na najvišim nivoima tokom stresa (odgovor borbe ili bijega). Primarna funkcija norepinefrina je pripremiti tijelo za akciju. Povećava budnost, poboljšava memorijske funkcije i pomaže u fokusiranju pažnje. Norepinefrin povećava broj otkucaja srca i krvni pritisak, povećava nivo glukoze u krvi i dotok krvi u skeletne mišiće i smanjuje dotok krvi u gastrointestinalni sistem.

      Norepinefrin se može ubrizgati kako bi se prevladao kritično nizak krvni tlak, a lijekovi koji suzbijaju njegove učinke koriste se za liječenje srčanih oboljenja. &alfa-blokatori se, na primjer, koriste za borbu protiv kardiovaskularnih i psihijatrijskih poremećaja. & beta-blokatori suzbijaju drugačiji skup efekata norepinefrina i rsquosa od & alfa-blokatora i koriste se za liječenje glaukoma, migrenskih glavobolja i drugih kardiovaskularnih problema.

      Porodica aminokiselina izvedenih iz piruvata ima četiri člana, svaki sa jednostavnim alifatskim bočnim lancem ne dužim od četiri ugljika. Najjednostavniji od njih je alanin.

      Alanin je aminokiselina koja se najlakše proizvodi iz piruvata. Jednostavna transaminacija koju katalizira alanin transaminaza proizvodi alanin iz piruvata.

      Alternativni putevi sinteze alanina uključuju katabolizam valina, leucina i izoleucina.

      Glukoza-alaninski ciklus je važan ciklus azota povezan sa Cori ciklusom koji se javlja između mišićnih i jetrenih ćelija u telu (vidi OVDE). U njemu razgradnja glukoze u mišićima dovodi do stvaranja piruvata. Kada je nivo dušika visok, piruvat se transaminira u alanin, koji se izvozi u hepatocite.

      U stanicama jetre dolazi do posljednje transaminacije ciklusa glukoza-alanin. Aminska grupa alanina se prenosi u & alfa-ketoglutarat za proizvodnju piruvata i glutamata. Glukoza se tada može proizvesti glukoneogenezom iz piruvata. Važno je da razlaganje glutamata daje amonijum jon, koji se može pretvoriti u ureu za izlučivanje, čime se smanjuje opterećenje organizma potencijalno toksičnim aminima. Ovaj put može biti posebno važan u mozgu.

      Drugi način uklanjanja viška amonijaka iz tkiva je njegovo pričvršćivanje na glutamat za stvaranje glutamina. Glutamat je neurotransmiter, pa je važno imati alternativni način uklanjanja amina (ciklus glukoza-alanin), posebno u mozgu.

      Kao i valin i izoleucin, leucin je esencijalna aminokiselina u ljudima. U masnom tkivu i mišićima, leucin se koristi u sintezi sterola. Jedina je aminokiselina koja stimulira sintezu mišićnih proteina, a kao dodatak ishrani starijih pacova usporava degradaciju mišića. Leucin je aktivator mTOR, proteina za koji se pokazalo da, kada je inhibiran, produžava životni vijek kod Saccharomyces cerevisiae, C. elegans i Drosophila melanogaster.

      Metabolizam leucina, valina i izoleucina (koji se nazivaju i aminokiseline razgranatog lanca - BCAA) započinje dekarboksilacijom piruvata i vezivanjem dvokarbonskog hidroksietilnog fragmenta na tiamin pirofosfat (slika 6.161). Metabolizam izoleucina se nastavlja vezivanjem hidroksiliranog dva ugljenika (hidroksietil-TPP) za &alfa-ketobutirat i pokriven je u odjeljku koji opisuje tu aminokiselinu (vidi OVDJE).

      Metabolizam valina i leucina nastavlja se vezivanjem hidroksietilnog komada iz TPP-a na drugi piruvat za stvaranje & alfa-acetolaktata. Preuređenje &alfa-acetolaktata acetolaktat mutazom stvara 3-hidroksi-3-metil-2-oksobutanoat.

      Redukcija sa NAD(P)H izomeroreduktazom acetohidroksi kiseline daje &alfa,&beta-dihidroksiizovalerat.

      Gubitak vode, kataliziran dihidroksikiselinom dehidratazom, proizvodi & alfa-ketoisovalerat.

      Ovaj molekul je grana za sintezu leucina i valina. Dodavanjem acetilne grupe iz acetil-CoA dobiva se alfa-izopropilmalat (kataliziran & alfa-izopropilmalat sintazom).

      Preuređenje, katalizirano izopropilmalat dehidratazom, dovodi do &beta-izopropilmalata.

      Oksidacija izopropilmalat dehidrogenazom i NAD+daje & alfa-ketoizokaproat.

      Njegova transaminacija (katalizirana leucin aminotransferazom i upotrebom glutamata) daje konačni proizvod leucina (vrh sljedeće kolone).

      Esencijalna aminokiselina u ljudima, valin se u biljkama dobiva iz piruvata i dijeli svoj put metaboličke sinteze s leucinom, a mali dio s izoleucinom. Metabolizam sve tri aminokiseline počinje dekarboksilacijom piruvata i vezivanjem hidroksietilnog fragmenta sa dva ugljika na tiamin pirofosfat (slika 6.161), kao što je gore navedeno.

      Kao što je ranije viđeno, & alfa-ketoisovalerat je molekula na mjestu metaboličkog puta u kojem dolazi do sinteze grana valina od one leucina. Zapravo, & alfa-ketoisovalerat je samo jedan korak udaljen od valina. Transaminacija &alfa-ketoizovalerata katalizirana valin izoleucin aminotransferazom daje valin.

      Sinteza izoeleucina (esencijalne aminokiseline kod ljudi) počinje u biljkama i mikroorganizmima sa piruvatom i &alfa-ketobutiratom (nusprodukt metabolizma treonina - treonin deaminaza - slika 6.162).

      Metabolizam izoleucina se nastavlja vezivanjem za & alfa-ketobutirat hidroksietil-TPP produkta dekarboksilacije piruvata kako bi nastao & alpha-aceto- & alfa-hidroksibutirat. Reakciju katalizira acetolaktat sintaza. Preuređivanje i redukcija izomeroreduktaze acetohidroksi kiseline i NAD (P) H daje & alpha, & beta-dihydroxy- & beta-methylvalerate. Prikazano na sljedećoj stranici.

      Gubitak vode (kataliziran dehidratazom dihidroksi kiseline) daje & alpha-keto- & beta-metilvalerat.

      &Tauransaminacija (koristeći glutamat i valin izoleucin transaminazu) daje izoleucin.

      Zanimljivo je da nekoliko enzima metabolizma valina katalizira reakcije na putu izoleucina. Iako se podloge malo razlikuju, one su dovoljne poput međuprodukata valina da se prepoznaju kao podloge.

      Izoleucin ima drugi asimetrični centar unutar sebe, ali se samo jedan izomerni oblik od četiri moguća iz dva centra nalazi biološki.

      Regulacija sinteze aminokiselina razgranatog lanca (BCAA - valin, leucin i izoleucin) je složena. Ključni molekul u regulaciji je & alfa-ketobutirat, koji se sintetizira u stanicama kao produkt razgradnje treonina. Enzim koji katalizira njegovu sintezu je treonin deaminaza (slika 6.162), koja je alosterijski regulirana. Enzim se inhibira vlastitim proizvodom (izoleucin) i aktivira valinom, produktom paralelnog puta.

      Stoga, kada je koncentracija valina visoka, ravnoteža se mijenja u korist proizvodnje izoleucina, a budući da se izoleucin natječe s valinom i leucinom za hidroksietil-TPP, sinteza ove dvije aminokiseline se smanjuje. Kad se koncentracija izoleucina poveća, treonin deaminaza se inhibira, prebacujući ravnotežu natrag u proizvodnju valina i leucina.

      Slabljenje

      Još jedan kontrolni mehanizam za regulaciju sinteze leucina javlja se u bakterijama i poznat je kao slabljenje. U ovoj metodi, nakupljanje leucina ubrzava proces translacije dijela kopije mRNA leucinskog operona (kodirajuće sekvence za enzime potrebne za stvaranje leucina). To, pak, uzrokuje preuranjenu transkripciju gena leucinskog operona, čime se zaustavlja proizvodnja enzima potrebnih za stvaranje leucina.

      Kad nivo leucina padne, translacija se usporava, sprječavajući prijevremenu transkripciju i omogućavajući stvaranje metaboličkih enzima leucina. Dakle, razina leucina u stanici kontrolira sintezu enzima neophodnih za njegovu proizvodnju.


      1. Tian P
      2. Steward A
      3. Kudva R
      4. Su T
      5. Shilling PJ
      6. Nickson AA
      7. Hollins JJ
      8. Beckmann R
      9. von Heijne G
      10. Clarke J
      11. Najbolji RB

      U interesu transparentnosti, eLife objavljuje najbitnije zahtjeve za reviziju i propratne autorske odgovore.

      Ovo je elegantan izvještaj o sveprisutnom procesu umetanja membranskih proteina, proučavan in vivo i in vitro koristeći bakterijski model E. coli – iskorištavanje tri uzorka membranskih proteina sve veće topološke složenosti. Eksploatacija analize profila sila (FPA) razvijena u von Heijne laboratoriji - sada u visokoj rezoluciji - pokazala se vrlo moćnom i komplementarnom s drugim tehnikama kao što su MD simulacije (također primijenjene ovdje). Ishod je novo znanje o molekularnim detaljima umetanja membranskih proteina. Važno je istaknuti da rad otkriva niz vrlo zanimljivih aspekata ovog procesa.

      Pismo odluke nakon stručne provjere:

      Hvala vam što ste poslali svoj članak "Analiza ostataka po ostacima integracije proteina membranske proteine ​​in vivo" na razmatranje od strane eLife. Vaš članak su recenzirala tri recenzenta, a evaluaciju su nadgledali urednik recenzije i Olga Boudker kao viši urednik. Sljedeća osoba uključena u razmatranje vašeg podneska pristala je otkriti svoj identitet: Ian Collinson (recenzent br. 2).

      Recenzenti su međusobno razgovarali o recenzijama, a urednik za recenziju je sastavio ovu odluku kako bi vam pomogao da pripremite revidirani podnesak.

      Željeli bismo skrenuti vašu pažnju na promjene u našoj politici revizije koje smo napravili kao odgovor na COVID-19 (https://elifesciences.org/articles/57162). Konkretno, tražimo od urednika da bez odlaganja prihvate rukopise, poput vašeg, za koje procijene da mogu postojati eLife radova bez dodatnih podataka, čak i ako smatraju da bi rukopis ojačali. Stoga se dolje tražene revizije odnose samo na jasnoću i prezentaciju.

      Ovo je elegantan izvještaj o sveprisutnom procesu umetanja membranskih proteina, proučavan in vivo i in vitro koristeći bakterijski model E. coli - eksploatacijom tri uzorka membranskih proteina sve veće topološke složenosti.

      Naše znanje o mehanizmu umetanja membranskih proteina donekle je površno i autori vode u tom području. Ovaj rukopis je odličan primjer - i stoga je vrijedan objavljivanja u bliskoj sadašnjoj formi (zasigurno više nisu potrebni eksperimenti).

      Eksploatacija analize profila sila (FPA) razvijena u von Heijne laboratoriji - sada u visokoj rezoluciji - pokazala se vrlo moćnom i komplementarnom s drugim tehnikama kao što su MD simulacije (također primijenjene ovdje). Rezultat je nova saznanja o molekularnim detaljima umetanja membranskog proteina. Važno je istaknuti da rad otkriva niz vrlo zanimljivih aspekata ovog procesa:

      Ovo je elegantan izvještaj o sveprisutnom procesu umetanja membranskih proteina, proučavan in vivo i in vitro pomoću bakterijskog modela E. coli - eksploatacijom tri uzorka membranskih proteina sve veće topološke složenosti.

      Naše znanje o mehanizmu insercije membranskih proteina je donekle površno i autori prednjače u ovoj oblasti. Ovaj rukopis je izvrstan primjer – i stoga dostojan objavljivanja u svom sadašnjem obliku (svakako više nisu potrebni eksperimenti).

      Eksploatacija analize profila sila (FPA) razvijena u von Heijne laboratoriji - sada u visokoj rezoluciji - pokazala se vrlo moćnom i komplementarnom s drugim tehnikama kao što su MD simulacije (također primijenjene ovdje). Rezultat je nova saznanja o molekularnim detaljima umetanja membranskog proteina. Važno je istaknuti da rad otkriva niz vrlo zanimljivih aspekata ovog procesa:

      Sljedeći je izvod iz sesije konsultacija u kojoj se navode ključne tačke za koje recenzenti smatraju da treba da budu adresirane u vašem revidiranom podnesku. Uključio sam kompletne komentare recenzenata na vaše razmatranje. Međutim, to ne mora biti detaljno obrađeno u vašem odgovoru koji prati isporuku vašeg revidiranog rukopisa.

      Postoji niz tehničkih pitanja koja treba riješiti u revidiranom tekstu, uključujući zaključke koje je potrebno prilagoditi. Ako ko-translacijsko savijanje polipeptidnih segmenata u tunelu ribosoma može utjecati na proces integracije (za što autori tvrde da se događa), u nekim je slučajevima problematično koristiti Lep fuzije za rješavanje tehničkih problema s otkrivanjem. U tim slučajevima izvorni polipeptid više nije kontekst za ovaj problem otkrivanja.

      Možda bi autori mogli da pokažu da prisustvo fuzionih proteina ne utiče na profile sile? Naravno, ako to utiče na rezultate, zaključke treba u skladu s tim promijeniti.

      Međutim, možda će biti teško to uvjerljivo pokazati s obzirom na to da je upotreba Lepa s Btu omogućila tumačenje uzorka proteinske trake. Implikacija je da Lep utiče na proces integracije ili preklapanja. Nadalje, autori tvrde da sekvence uzvodno od N-kraja mogu utjecati na integraciju ko-translacijskim presavijanjem kao u slučaju NTD regije u GlpG. Stoga zamjena Lepa za takve sekvence može ometati proces savijanja/integracije.

      S obzirom na prethodnu dobru saglasnost von Heijne grupe sa MD simulacijama, možda bi se ovaj pristup mogao koristiti za pristup divergenciji od domaćeg ponašanja.

      Možda bi trenutna analiza bila prihvatljiva za konstrukte koji su dovoljno dugi (Za GlpP, N & gt120 LepB dio dug 58 ostataka potpuno je izložen izvan ribosoma i ne zahvaća SecY). GlpP je vjerovatno u redu s tim u vezi jer su LepB-spojeni konstrukti N = 131-224. Naravno, LepB ima membransko sidro i ne znamo kako je to moglo utjecati na FP GlpP -a. Možda imaju neke izvorne GlpG podatke osim onih s više opsega, što bi moglo biti korisno. Za BtuC, oni pokazuju barem neke podatke bez LepB fuzije (Slika 4—dodatak slike 1B). Ovo je lepo posebno jer se radi o kraćim konstrukcijama na koje je LepB mogao više uticati. Ipak, potencijalne opaske u njihovim tumačenjima podnose ispravke.

      Moglo bi biti korisno uključiti sirove slike i neka pojašnjenja u vezi statistike za eksperimente u kojima su postojala samo 2 biološka ponavljanja.

      Glavna pitanja koja su gore sažeta mogu se pozabaviti autorima bez dodatnih eksperimenata. Recenzent #1 nudi dodatne eksperimentalne testove, ali se oni ne smatraju neophodnim za zadovoljavajuću reviziju ovog najzanimljivijeg rada.

      Rukopis Nicolausa et al. je slijedila ko-translacijska integracija tri membranska proteina s više raspona koristeći analizu profila sile (FP), metodu koju je prethodno uvela von Heijne grupa. Ovaj pristup koristi fuziju C-terminalnog peptida za zaustavljanje prevođenja u topljive ili membranske proteine ​​različitih krnja. Sklapanje ili membranska integracija novonastalog lanca proizvodi silu povlačenja, koja se može očitati iz toga koliko efikasno hapšenje peptida uzrokuje translacijsko zastoj. Ranije je grupa detaljno analizirala membransko umetanje modela pojedinačnih transmembranskih spirala (TMH) (Ismail et al., 2012). Sada su proširili pristup na više proteza (i više prirodnih) membranskih proteina, naime EmrE, GlpG i BtuC. Autori su zaključili da njihovi podaci podržavaju takozvani "klizni" model za TMH integraciju, gdje svaki TMH klizi prema otvorenim bočnim vratima kanala SecYEG. Oni takođe predstavljaju nekoliko zanimljivih zapažanja, kao što su efekti naelektrisanih ostataka, re-entrant petlji i površinskih spirala na vremenske prilike TMS integracije, iako bi to zahtevalo više podataka za generalizaciju.

      Glavna slabost studije je njeno isključivo oslanjanje na analizu FP -a. Korištene su i grube zrnaste MD simulacije, ali radije za potvrdu zapažanja iz FP analize. Ograničenje FP analize je to što samo prati (indirektno) umetanje posljednjeg TMH koji je blizu SecYEG kanala. Analiza se ne bavi onim što bi se dogodilo sa ranijim TMH-ovima (kao što je savijanje TMD-a, odgođeno umetanje ili moguće okretanje TM-a) kako polipeptid raste. Druga slabost bi bila to što studija dodaje samo prilično mala ažuriranja (efekti naelektrisanih ostataka, re-entrant petlje i površinske spirale) prethodnom modelu.

      Unatoč slabostima, ovaj rad pruža korisne uvide i izvore na terenu, pa ga smatram prikladnim za objavljivanje u eLife sa revizijom. Membranska integracija membranskih proteina sa više raspona je još uvijek slabo shvaćen proces, uglavnom zato što postoji vrlo malo eksperimentalnih alata dostupnih istraživačima da prate proces. Analiza autora općenito je visoke kvalitete, a njihova tumačenja razumna.

      1) Naučnike izvan područja vjerovatno je teško pratiti trenutnu verziju rukopisa. Bilo bi bolje proširiti Uvod kako bi se stručnjacima pružilo više osnovnih informacija o putu, kao što je opći model za translokaciju proteina posredovanu SecYEG-om i integraciju membrane, ono što je poznato o integraciji membranskih proteina i koja su glavna pitanja adresa.

      2) Kao u tački 1, crtani lik koji prikazuje "klizni" model opisan u diskusiji bio bi od pomoći za poboljšanje čitljivosti.

      3) U vezi sa tačkom #2. Iako autori to nisu izričito spomenuli, model suprotan kliznom modelu bio bi model "in-out", gdje se TMS prvo spušta duž translokacijske pore, a zatim se kroz otvorena bočna vrata dijeli u lipidnu fazu. Međutim, po mom mišljenju, mehaničke razlike između ova dva modela su prilično male, a granica između lateralne kapije i pora nije jasna (također, lipidi mogu djelomično ubaciti acilne repove u otvorena lateralna vrata i kontaktirati polipeptidni lanac u pore). Autori bi trebali jasno opisati zašto se podaci uklapaju u model "klizanja", a ne u model "in-out". Nejasno je i "klizanje duž otvorene bočne kapije". Moguće je da TMH ostane tik izvan lateralne kapije dok klizi preko membrane (slično strukturama koje se vide u studijama translokacijskih intermedijara koji sadrže TMH ili signalne sekvence).

      4) U prethodnoj studiji Ismaila i sur., Primijećena je dvofazna sila povlačenja. U trenutnoj studiji, čini se da FP ne pokazuju jasno takav dvofazni obrazac. Mogu li autori raspravljati o tome?

      5) Za neka zapažanja, autori jednostavno kažu da će biti potrebne daljnje studije za razumijevanje (na primjer, dugotrajne interakcije ostatak-ostatak). Umjesto toga, autori bi trebali barem dati moguće objašnjenje ili predložiti provjerljivu hipotezu.

      6) „Slično, pik VI-a vjerovatno odražava integraciju membrane hidrofobnog, membranom povezanog citoplazmatskog segmenta koji se nalazi odmah uzvodno od TMH5, Slika 3—dodatak slike 1B. Nasuprot tome, neočekivano visok Nstart vrijednost za vrh IV označava da integracija TMH3 počinje tek kada je njegov kraj N-terminala

      52 ostatka dalje od PTC-a, vjerovatno zbog malog razmaka između TMH2 i TMH3.” Oni se možda mogu testirati mutagenezom i umetanjem hidrofilnog rastezanja između TMH2 i TMH3. Kako bi uski razmak između TMH2 i TMH3 mogao uzrokovati odgođeno umetanje TMH3?

      7) Osnova za Nstart i Nmax za magenta (mutant) grafikon na slici 3D nije jasan jer izgleda da postoje tri lokalna vrha. Šta predstavljaju ovi lokalni vrhovi i minimumi?

      8) Autori općenito koriste samo Nstart pozicije za tumačenje. Ali zanimljivo je da su širine vrhova prilično varijabilne među TMH. Postoji li korelacija između širina vrhova i TMH sekvenci (ili njihovih strukturnih svojstava)?

      9) Završni pasus rezultata: Zagonetno je zašto nema vučne sile za TMH6 već dva snažna vrha prije i poslije. Mogu li autori ponuditi objašnjenje za ovo zapažanje izvan opće tvrdnje? Da li mutacije u periplazmatskom re-entrant helixu utiču na pikove?

      Ovo je elegantan izvještaj o sveprisutnom procesu umetanja membranskih proteina, proučavan in vivo i in vitro koristeći bakterijski model E. coli - eksploatacijom tri uzorka membranskih proteina sve veće topološke složenosti.

      Naše znanje o mehanizmu umetanja membranskih proteina donekle je površno i autori vode u tom području. Ovaj rukopis je izvrstan primjer – i stoga dostojan objavljivanja u svom sadašnjem obliku (svakako više nisu potrebni eksperimenti).

      Eksploatacija analize profila sila (FPA) razvijena u von Heijne laboratoriji – sada u visokoj rezoluciji – pokazala se vrlo moćnom i komplementarnom drugim tehnikama kao što su MD simulacije (takođe primijenjene ovdje). Ishod je novo znanje o molekularnim detaljima umetanja membranskih proteina. Važno je da rad otkriva niz vrlo zanimljivih aspekata ovog procesa:

      - sposobnost rastvorljivih citosolnih domena da se presavijaju dok su još u izlaznom tunelu ribosoma

      - zamjene aa specifične za lokaciju mogu imati dugoročne učinke na FPA, što ukazuje na kooperativno preklapanje i umetanje TMH.

      – transmembranske spirale (TMH) vrlo brzo gube svoju „moć vuče“, što se tumači kao rani ulazak u membranu.

      Rezultati podržavaju dokaz izgradnje u korist “kliznog modela” za umetanje membranskog proteina, pri čemu su ugrađeni TMH uvijek u kontaktu sa lipidima na međusloju između Sec kompleksa i dvosloja.

      Nemam nikakvu suštinsku zabrinutost oko posla. Čestitam autorima na studiji. Razumijem da je to morao biti veliki posao.

      Tehnički, ovo je veoma napredna studija. Međutim, postoje tehnički problemi s podacima koje autori zanemaruju ili marginaliziraju, ali to može utjecati na zaključke rada na pojedinačnim membranskim proteinima. To se posebno odnosi na upotrebu Lep sekvenci u fuzijama proteina za dobijanje više "interpretabilnih" podataka.

      Na slici 1 prikazani su primjeri za tri membranska proteina testirana kako se primjenjuje FPA. Ovo su sve SDS-PAGE/puls chase mjerenja sa membranskim proteinskim krnjem koje je zaustavio translacijski peptid za zaustavljanje. Ovisno o konstrukciji, za podešavanje prozora sile koriste se različiti peptidi za zaustavljanje. Ova vrsta eksperimenata je urađena za veoma veliki skup skraćenih proteina, a ovi podaci su sažeti na slikama 2-4 u grafovima položaja naspram sile. Autori bi trebali učiniti sirove podatke (SDS-PAGE slike kao na slici 1C) dostupnim kao vanjski izvor kako bi se stvarni podaci mogli provjeriti.

      Dostupnost podataka: Uz trenutnu prezentaciju ne postoji način pristupa kvaliteti podataka. Da postoje nejasnoće vidljivo je već sa slike 1C sa EmrE. Čini se da se uhapšeni peptid prikazuje kao dvije trake što signalizira problem o kojem se dalje ne govori. Nije jasno je li donja traka uključena u određivanje intenziteta A, niti je jasno koja je priroda ove proteinske trake. Budući da sirovi podaci nisu dostupni, teško je pristupiti da li ima još problema sa podacima i kako bi to uticalo na ishod rada.

      Očigledno, s GlpG-om, konstrukti sa N 140-160 doveli su do pojave više traka na SDS-PAGE-u koje je bilo teško interpretirati. Ovaj problem je riješen fuzijom dijela proteina Lep na N-kraj GlpG. Lep deo se nalazi u tunelu ribosoma sa proteinskim konstruktima zaustavljenim AP. Ovo izgleda nezadovoljavajuće jer je sekvenca Lep koja je potpuno irelevantna za proces integracije GlpG -a. Pošto ova Lep sekvenca očigledno utiče na obrazac proteinske trake, očigledno nije invarijantna za celokupni proces. Stoga je teško tvrditi da se upotrebom ekstenzija Lep dobivaju značajni podaci.

      Vezano za gornji komentar, takođe sa BtuC -om, koriste se Lep fuzije. Ako ko-translacijsko presavijanje u tunelu ribosoma može utjecati na izmjerene sile, kako autori tvrde, zamjena dijelova GlpP i BtuC s Lepom svakako će utjecati na ishod rada.

      Autori tvrde da dolazi do kotranslacionog savijanja NTD GlpG u tunelu ribosoma.Pod preklapanjem autori vjerovatno misle na sekundarno formiranje strukture? U eksperimentalnoj postavci koriste se zaustavljeni lanci, a prije očitavanja potrebno je izvršiti dugu biokemijsku obradu. Kako autori mogu biti sigurni da je ovo preklapanje relevantno i za pravi, neometan proces prevođenja/integracije? Ovdje se fiziološki značaj promatranja treba tretirati s oprezom.


      DISKUSIJA

      Analizom tačkastih mutacija i upotrebom fosfo-specifičnog antitijela, pokazali smo da za vezivanje DYRK1A na 14-3-3β potrebna je fosforilacija Ser-520, ostatka koji se nalazi na C kraju proteina i uokviren u 14-3-3-način konsenzusa I motiv. Ranije je prijavljeno povezivanje DYRK1A i 14-3-3 (Kim et al., 2004), ali autori nisu identificirali bilo kakav zahtjev za fosforilacijom za interakciju. Jedno objašnjenje za ovaj naizgled kontradiktoran rezultat može biti različita otpornost prema fosfataznom tretmanu fosforiliranog Ser-520 i fosforiliranih Tyr ostataka koje je koristio Kim et al. (2004) kao kontrola za njihov tretman fosfatazom (dodatna slika S3, C). Drugo moguće objašnjenje moglo bi ležati na postojanju različitih eksperimentalnih uvjeta ili specifičnosti izotipa 14-3-3. Ipak, svi eksperimentalni dokazi dati u ovoj studiji snažno sugeriraju da interakcija između DYRK1A i 14-3-3β ovisi o fosforilaciji, kao što je slučaj za većinu 14-3-3 partnera (Aitken, 2006).

      Osim mjesta vezivanja fosfo-Ser-520, postoji i druga 14-3-3 interaktivna domena u DYRK1A, unutar prvih 150 aminokiselina N terminala. Čini se da su obje lokacije potrebne za vezivanje 14-3-3, jer mutacija bilo koje od njih uvelike smanjuje interakciju. Prisutnost dva mjesta vezivanja 14-3-3 na jednom polipeptidu povećava afinitet vezivanja 14-3-3 za više od 30 puta (Yaffe et al., 1997.) i nekoliko meta 14-3-3, poput DAF-16 (Cahill et al., 2001) i Cdc25B (Giles et al., 2003), prijavljeno je da zahtijeva postojanje više od jednog mjesta vezivanja za stabilnu asocijaciju 14-3-3. S obzirom na dimernu prirodu 14-3-3, postoji mogućnost da se molekul DYRK1A veže za 14-3-3 dimer kroz kontakte između motiva fosfo-Ser-520 i jednog monomera 14-3-3, a između drugog motiv vezivanja na N kraju i drugom monomeru. Na temelju činjenice da se N-terminalna regija DYRK1A može vezati za 14-3-3 kada je spojena s heterolognim proteinom, ali ne u kontekstu mutacije Ser-520, predlažemo da bi 14-3-3 prvo moglo prepoznati i vezati se za motiv fosfo-Ser-520, što bi olakšalo vezivanje za drugo mjesto vezanja 14-3-3 na N kraju, što rezultira stabilizacijom kompleksa.

      Osim 14-3-3β, otkrili smo da DYRK1A može vezati i 14-3-3η (dopunska slika S7). Dvije nedavne proteomske analize identificirale su DYRK1A kao jedan od proteina prisutnih u kompleksima 14-3-3 izooblika γ i σ (Jin et al., 2004 Benzinger et al., 2005.) i Kim et al. (2004) prijavili su interakciju sa izoformom 14-3-3ε. Iako bi ovi podaci ukazivali na to da je DYRK1A u stanju interakcije s nekoliko 14-3-3 izooblika, bit će potrebno dodatno istraživanje kako bi se utvrdilo postoji li selektivnost u interakcijama DYRK1A/14-3-3.

      Čini se da stanje fosforilacije nekih 14-3-3 izoformi, uključujući izoformu β, regulira i dimerizaciju i vezivanje cilja (Yoshida et al., 2005.). Tako smo provjerili može li DYRK1A djelovati kao navodna 14-3-3 kinaza. Nismo pronašli značajnu fosforilaciju 14-3-3β in vitro testovima kinaze (dopunska slika S8), što ukazuje na to da to nije slučaj.

      Rezultati dokumentirani u ovom rukopisu podržavaju ideju da je fosforilacija DYRK1A u Ser-520 intramolekularni događaj autofosforilacije. Fosforilirani ostatak Ser nije lociran na nedvosmislenom mjestu konsenzusa DYRK1A, jer postoji Asp umjesto Pro u položaju P+1, međutim, prisustvo Arga na P -3 prilagodilo bi se preferencijama DYRK1A na tom položaju (Himpel et al., 2000). Vrijedi napomenuti da je definicija DYRK1A konsenzusne fosforilacijske sekvence zasnovana na međumolekulskim reakcijama na peptide, te je moguće zamisliti da su za unutarmolekularne reakcije autofosforilacije potrebni i drugi zahtjevi sekvence.

      Status fosforilacije Ser-520 ne ometa Tyr-ovu autofosforilaciju, što ukazuje na to da je autofosforilacija petlje aktivacije DYRK1A vrlo vjerojatno raniji događaj. Štaviše, možemo otkriti fosforilaciju endogenog DYRK1A na Ser-520 in vivo. Stoga, osim Tyr-321 aktivacijske petlje, Ser-520 predstavlja jedini in vivo fosfozit DYRK1A do sada identificiran.

      Na prvom razmatranju, može se pretpostaviti da je događaj autofosforilacije stehiometrijski, ali imunoblot obrasci ukupnog DYRK1A i pS520 nisu bili potpuno ekvivalentni kada je kinaza egzogeno eksprimirana u stanicama i bakterijama sisara. Štaviše, nivoi fosforilacije Ser-520 bili su niži u ćelijama sisara nego u bakterijski eksprimiranom proteinu, u rasponu od 10 do 40% rekombinantnog proteina. To nas je navelo na pomisao da nisu svi DYRK1A molekuli fosforilirani in vivo. Ovaj prijedlog potkrepljen je dinamičkim promjenama nivoa fosforilacije Ser-520 endogenog DYRK1A primijećenim kao odgovor na stimulaciju bFGF. Iako ne možemo isključiti mogućnost da bFGF signalizacija utječe na samu aktivnost autofosforilacije, čini se vjerojatnijim da signalizacija utječe na stabilnost fosforiliranog Ser-520. To se može postići aktivacijom Ser-520 fosfataze i/ili ometanjem vezanja 14-3-3, što bi moglo zaštititi Ser-520 od defosforilacije, kao što je nedavno prijavljeno za Ser-526 u mitogen-aktiviranoj protein kinaza kinazi kinaza 3 (MEKK3) (Fritz et al., 2006).

      Posebno zanimljiva posljedica interakcije između DYRK1A i 14-3-3 je pozitivna regulacija aktivnosti kinaze DYRK1A. Čini se da 14-3-3β povećava katalitičku aktivnost rekombinantnog DYRK1A samo prema egzogenim supstratima, jer nije otkriven efekat na autofosforilaciju DYRK1A (dopunska slika 8). Mehanički, može se predvidjeti nekoliko scenarija. U jednom od njih, učinak zahtijeva vezivanje kroz oba 14-3-3 mjesta vezivanja, u skladu s modelom u kojem bi vezivanje dimernog 14-3-3 na dva mjesta vezanja na DYRK1A moglo inducirati konformacijsku promjenu u DYRK1A koja pojačava njegovo enzimska aktivnost. Ovaj mehanizam je predložen za druge enzime koji su regulirani 14-3-3 proteinima, kao što su N-acetiltransferaza (Obsil et al., 2001). Alternativno, N-terminalna regija djeluje kao strukturni zahtjev za stabilizaciju aktivnije konformacije, u skladu sa smanjenom bazalnom katalitičkom aktivnošću N-terminalnog deletiranog mutanta prema egzogenim supstratima. U tom kontekstu, DYRK1A bi zauzimao samo jedno od mjesta vezivanja u 14-3-3 dimeru, ostavljajući drugo na raspolaganju za regrutiranje ili DYRK1A supstrata ili efektora. Ovo je prijavljeno, na primjer, za jedno od 14-3-3 veznih mjesta u Raf proteinima, gdje 14-3-3 funkcionira kao skela koja posreduje u heterooligomerizaciji između C-Raf i B-Raf kinaza (Garnett et al., 2005.). S tim u vezi vrijedi spomenuti da su tau i FKHR, dvije dobro poznate mete 14-3-3, podloge DYRK1A (Woods et al., 2001).

      Za samo nekoliko kinaza koje vezuju 14-3-3 prijavljeno je da moduliraju svoju aktivnost kao rezultat ove interakcije (Tabela 1). U svim slučajevima, vezivanje 14-3-3 zavisi od fosforiliranog motiva. Fosforilirani ostatak može se pojaviti unutar ili izvan katalitičke domene, a vezivanje 14-3-3 može dovesti ili do inhibicije ili do aktivacije kinazne aktivnosti. Iako je u nekim slučajevima fosforilacija u motivima vezivanja 14-3-3 posredovana uzvodnom kinazom, postoje tri druge kinaze, pored DYRK1A, za koje je poznato da je vezivanje za 14-3-3 regulirano autofosforilacijom. U slučajevima MEKK3 (Fritz et al., 2006) i protein kinaza-1 zavisna od 3-fosfoinozitida (Sato et al., 2002), katalitička aktivnost je promijenjena vezivanjem 14-3-3 za autofosforilirani ostatak unutar aktivacijske petlje. Za protein kinazu C (PKC) μ, vezivanje 14-3-3 unutar regulatorne domene C1 inhibira aktivnost PKC kinaze (Hausser et al., 1999). Prema tome, prema našim saznanjima, DYRK1A predstavlja jedini slučaj u kojem autofosforilacija mjesta izvan katalitičkog domena dovodi do pojačane aktivnosti kinaze nakon vezivanja 14-3-3. Štaviše, čini se da je ovaj mehanizam specifičan za DYRK1A, jer motiv Ser-520 nije sačuvan kod drugih članova porodice DYRK.

      Tablica 1. Učinak vezanja 14-3-3 na aktivnost proteinskih kinaza sisavaca


      Pogledajte video: Kemija 4. r. SŠ - Aminokiseline (Decembar 2022).