Informacije

Postoje li in vivo dokazi o amiloidnoj beta toksičnosti?

Postoje li in vivo dokazi o amiloidnoj beta toksičnosti?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Smatra se da je amiloid beta toksičan, međutim, iz kratke pretrage, ovo se zasniva na (1) in vitro (2) mjerenjima nekih proksija toksičnosti (npr. ultraosjetljivo mjerenje priliva Ca2+ u lipidne vezikule inducirano proteinskim agregatima referenciranim na Wikipediji) .

Moj utisak je da nemamo nikakve visokokvalitetne dokaze da je amiloid beta toksičan in vivo i da postoje značajni posredni dokazi da je toksičan (linkovi ispod). Je to tačno?

  1. "30% starijih ljudi ima #Alchajmerovu patologiju (plakove i/ili zapetljane), ali nema bolest"
  2. Postoji starija žena sa velikom količinom amiloidnih plakova, ali bez simptoma Alchajmerove bolesti
  3. Prema Dereku Loweu, "sva ta ispitivanja amiloidnih antitijela završila su teškim, skupim neuspjesima"

Iz brze pretrage, čini se da postoji mnogo čvrstih dokaza za to in vivo toksični efekti. Par radova ovdje i ovdje.


Sistematska in vivo analiza intrinzičnih determinanti patogenosti amiloida β

Odsjek za hemiju, Univerzitet u Kembridžu, Kembridž, Ujedinjeno Kraljevstvo, Odsjek za biohemiju, Univerzitet u Kembridžu, Kembridž, Ujedinjeno Kraljevstvo, Odsjek za genetiku, Univerzitet u Kembridžu, Kembridž, Ujedinjeno Kraljevstvo

Affiliation Dipartimento di Scienze Biochimiche, Università degli Studi di Firenze, Firenze, Italija

Odsjek za hemiju Univerziteta u Kembridžu, Kembridž, Ujedinjeno Kraljevstvo

Odsjek za medicinu, Univerzitet u Cambridgeu, Cambridge, Ujedinjeno Kraljevstvo, Cambridge Institute for Medical Research, Cambridge, Ujedinjeno Kraljevstvo

Odsjek za hemiju Univerziteta u Kembridžu, Kembridž, Ujedinjeno Kraljevstvo

* Kome treba uputiti prepisku. E-mail: [email protected]

Odsjek za genetiku, Univerzitet u Cambridgeu, Cambridge, Ujedinjeno Kraljevstvo, Odsjek za medicinu, Univerzitet Cambridge, Cambridge, Ujedinjeno Kraljevstvo


Uvod

Alchajmerovu bolest karakteriše taloženje u mozgu senilnih plakova, koji se uglavnom sastoje od β-amiloidnog peptida (Aβ). Hipoteza amiloidne kaskade postavlja da kod Alchajmerove bolesti, akumulacija Aβ u mozgu u konačnici dovodi do promjena u metabolizmu tau, što dovodi do taloženja taua u neurofibrilarnim čvorovima (NFT) koji su vjerojatni proksimalni uzrok gubitka neurona uočenog u ovoj bolest [25]. Iako još uvijek postoji značajna kontroverza oko toga da li hipoteza amiloidne kaskade objašnjava Alchajmerovu patologiju [28, 39, 72], postoje opsežni dokazi (in vitro i in vivo) da izlaganje neurona Aβ može dovesti do hiperfosforilacije taua, potencijalnog pokretača tau depozicije [23, 51, 87]. Identificirano je više tau kinaza (pregledano u [57]), kao i putevi pomoću kojih se te kinaze mogu aktivirati kako bi se povećala tau fosforilacija [15, 55, 89]. CDK5 i GSK3β su se pojavili kao jaki kandidati za tau kinaze relevantne za bolest [27, 50], a aktivacija obje ove kinaze može se dogoditi nizvodno od aktivacije kalpaina. Kalpaini su kalcijum zavisne proteaze koje mogu da cepaju P35 da bi proizvele P25, jak aktivator CDK5 [81] ili direktno skraćuju GSK3β, što dovodi do njegove aktivacije [34]. Mnoge studije su takođe pokazale da izlaganje neurona Aβ može dovesti do priliva kalcijuma [30, 77, 78] i stoga postoji dobro podržan molekularni mehanizam koji objašnjava kako izlaganje Aβ može dovesti do hiperfosforilacije tau. Manje je jasan biološki razlog za Aβ-indukovanu tau fosforilaciju. Je li ovo odabrana funkcija Aβ, indirektna posljedica evoluirane interakcije Aβ sa stanicama, ili suštinski slučajna interakcija s potencijalno štetnim ishodima?

Rješavanje pitanja "zašto" Aβ inducira tau fosforilaciju je komplikovano nesigurnošću u pogledu toga koju, ako postoji, odabranu funkciju Aβ peptida ima. Slično neriješeno je kako ekstracelularni Aβ inducira intracelularno povećanje kalcija. Aβ toksičnost u brojnim modelima može se ublažiti blokiranjem glutamatnog receptora tipa NMDA [5, 11, 24], što sugerira da bi ovaj kalcijumski kanal mogao biti odgovoran za Aβ ovisan priliv kalcijuma. Slično, za prionski protein se tvrdilo da je receptor za Aβ oligomere [7, 44, 74] i umjeren priliv kalcija zavisan od Aβ [67]. Druge studije su implicirale AMPA glutamatne receptore [2, 73, 88] ili L-tip naponsko vođene kalcijumske kanale [4] u povećanju kalcijuma u citoplazmi kao rezultat izlaganja Aβ. Dok bi višestruki kalcijumski kanali mogli biti uključeni u priliv kalcijuma ovisan o Aβ, druge studije sugeriraju da Aβ oligomeri mogu djelovati neovisno o endogenim kalcijumskim kanalima tako što direktno formiraju pore propustljive za kalcij. Odavno je poznato da sintetički Aβ može formirati kanale propusne za jone u sintetičkim membranama [6], nalaz koji se često ponavlja [29, 41, 71]. Iako su prstenaste strukture Aβ oligomera vizualizirane mikroskopijom atomske sile u sintetičkim membranama [46], pore Aβ membrane u patološki relevantnim stanicama nisu direktno vizualizirane ili analizirane.

Jedan pristup utvrđivanju jesu li Aβ pore relevantne za neurotoksičnost Aβ je da se identifikuju supstitucije u Aβ sekvenci koje blokiraju stvaranje pora u sintetičkim membranama, a zatim se utvrdi da li ove zamjene mijenjaju toksičnost Aβ. Kim i dr. [41] su zabilježili motiv sekvence (Gly-XXX-Gly-XXX-Gly) prisutan i na C-kraju Aβ i na transmembranskim domenima proteina bakterijskih kanala, te su predložili da bi ovaj motiv (“glicinski zatvarač”) mogao olakšati α-helikalne interakcije pokreću sklapanje Aβ oligomera u membranama i kasnije formiranje pora. Ovi istraživači su pokazali da su zamjene leucina na ovim ostacima glicina (posebno Gly 37 Leu) spriječile sintetički Aβ 1–42 da formira jonske kanale u sintetičkim membranama i također značajno smanjila toksičnost Aβ u Neuro 2A ćelijama. Fonte et al. [20] proširili su ove rezultate i pokazali da supstitucija Gly 37 Leu smanjuje toksičnost Aβ u in vivo transgenom C. elegans model koji eksprimira ljudski Aβ i sprečava sintetičke Aβ oligomere da izazovu hiperfosforilaciju tau u neuronima hipokampusa. Peters et al. [68] su kasnije pokazali da pentapeptid izveden iz sekvence glicinskog zatvarača (GLMVG) inhibira Aβ sinaptotoksičnost. Ova zapažanja su u skladu s formiranjem pora u osnovi neurotoksičnosti Aβ, ali ne pokazuju direktno formiranje pora i ne mogu isključiti druga tumačenja, kao što je mogućnost da zamjene glicinskog zatvarača ometaju interakcije sa specifičnim receptorima ćelijske površine.

Alternativni pristup zaključivanju o formiranju pora od strane Aβ je tražiti njegovu sposobnost da izazove poznati biološki odgovor na egzogeno inducirane pore, umjesto pokušaja da se snime same pore. Andrews i kolege su definirali put popravke membrane koji se javlja kao odgovor na izlaganje streptolizinu O, (SLO), dobro okarakteriziranom bakterijskom toksinu koji stvara pore [32]. Kao što je prikazano na slici 1, ovaj put popravke u više koraka uključuje: 1) dotok kalcija kroz SLO pore, 2) fuziju lokalnih lizosoma sa plazma membranom, oslobađanje lizosomskog sadržaja, 3) cijepanje obližnjih sfingolipida u vanjskom listiću plazma membranu kiselom sfingomijelinazom izvedenom iz lizozoma, izazivajući lokalizovanu unutrašnju zakrivljenost membrane, i 4) uklanjanje plazma membrane koja sadrži pore endocitozom. Dok se očito koriste različiti mehanizmi popravke membrane za različite klase toksina koji stvaraju pore [19], ako Aβ-induciran priliv kalcija rezultira iz SLO-analognih pora, mogu se napraviti tri snažna predviđanja: 1) izloženost Aβ će inducirati zavisnu od sfingomijelinaze endocitoza, 2) netoksične Aβ varijante (npr. Aβ42 Gly 37 Leu) neće biti u stanju da izazove popravku membrane jer ne mogu na odgovarajući način da oligomerizuju da formiraju pore na membrani, i 3) izlaganje toksinima koji stvaraju pore oponašaće efekte Aβ oligomera, posebno hiperfosforilaciju taua. Ovdje testiramo ova predviđanja koristeći roman C. elegans model i primarne kulture neurona hipokampusa štakora.

Model za popravku membrane. Ovaj model se temelji na mehanizmu za popravku pora plazma membrane (PM) stvorenih u stanicama sisara izlaganjem bakterijskom toksinu koji stvara pore SLO [32]. ASM je kisela spingomijelinaza koja se pohranjuje u lizosomima, koji se spajaju sa PM kao odgovor na priliv Ca2+ kroz pore stvorene SLO (Korak 1), čime se oslobađa ASM na površini ćelije (Korak 2). Lokalizirano oslobađanje ASM-a odcjepljuje fosforilnu glavu sfingomijelinaze u blizini pora kako bi se stvorio ceramid u tom području (korak 3). Posljedično, PM oko pore prolazi kroz unutrašnju krivinu i endocitozu tako da se pora uklanja iz PM (korak 4)

Transgenic C. elegans konstruirani su sojevi koji eksprimiraju humani Aβ42 [16,17,18, 47, 82], a ovi sojevi imaju različite fenotipove, ovisno o tome gdje je transgen eksprimiran. Konfuzija ovih modela je da je Aβ koji se može detektovati intracelularan kada se analizira imunohistohemijom, tako da je stepen toksičnosti van-unutar Aβ (tj. ekstracelularni Aβ koji utiče na susedne ćelije) nejasan. Da bismo zaobišli ovo ograničenje, razvili smo model “hranjenja”, gdje C. elegans je hranjen E. coli dizajniran da luči humani Aβ, a ćelijski efekti ovog egzogenog peptida se analiziraju u crijevnim stanicama. Jedno od razloga za ovaj model je da C. elegans crijeva ne eksprimiraju kandidate za Aβ receptore (npr., prionski protein, NMDA glutamatne receptore, α7nAChR, itd.), i stoga je malo vjerovatno da će bilo kakav fiziološki odgovor na Aβ biti posredovan receptorom. Transparentnost C. elegans i postojanje relevantnih transgenih reporterskih sojeva omogućava praćenje efekata izloženosti Aβ kod živih netaknutih životinja. Koristeći ovaj model, pokazujemo da je izloženost divljem tipu Aβ42 (ali ne i Aβ42 Gly 37 Leu) inducira endocitozu ovisnu o kiselini-sfingomijelinazi koja je paralelna s odgovorom na poznati toksin koji stvara pore, CRY5B. Otkrili smo da je ovaj odgovor na Aβ ovisan o kalpainu i da je promijenjen mutacijama gubitka funkcije u C. elegans ortolozi BIN1 i PICALM, dva gena za rizik od Alchajmerove bolesti identifikovana u studijama asocijacije na nivou genoma [61, 84]. U kulturama hipokampusa, pokazali smo da SLO toksin koji stvara pore inducira tau fosforilaciju ovisnu o kalpainu u primarnim neuronima. Nadalje, sama egzogena sfingomijelinaza može inducirati povećanu tau fosforilaciju u ovim neuronima. Konačno, koristimo novu metodu označavanja da pokažemo da supstitucija Gly 37 Leu zaista inhibira multimerizaciju Aβ u ćelijskom kontekstu, čime se racionalizuje zašto ova varijanta Aβ nije u stanju da izazove popravku membrane ili tau fosforilaciju. Uzeti zajedno, ovi rezultati podržavaju gledište da tau hiperfosforilacija može biti nizvodna posljedica procesa popravke membrane, i da egzogeni Aβ može inducirati popravak membrane zbog svoje sposobnosti da oligomerizira u pore membrane.


Abstract

Sve je više dokaza da klasa glikolipida ćelijske membrane, gangliozida, može posredovati u fibrilogenezi i toksičnosti amiloid-β peptida Alchajmerove bolesti (Aβ). Koristeći lipidne monoslojeve i vezikule kao modelne membrane, izmjerili smo inserciju Aβ u 1,2-dipalmitoil-lok-glicero-3-fosfoholin (DPPC)-gangliozid GM1 monoslojevi za ispitivanje Aβ−GM1 interakcije, prikazali su efekte umetanja Aβ na morfologiju monosloja i izmjerili brzinu formiranja Aβ fibrila kada se inkubiraju s 1-palmitoil-2-oleoil-lok-glicero-3-fosfoholin (POPC)-GM1 vezikule. Nadalje, lokacija Aβ asocijacije u monosloju procijenjena je eksperimentima fluorescencije sa dvostrukom sondom. Aβ je pokazao direktne i povoljne interakcije sa GM1 kako se umetanje Aβ monotono povećava sa GM1 koncentracija, uprkos povećanju krutosti monosloja pri niskom GM1 nivoa. Na niskom GM1 koncentracije, Aβ prvenstveno umetnut u neuređenu, tečnu ekspandiranu fazu. Na višoj GM1 koncentracijama, Aβ je umetnut ujednačenije u monosloj, što rezultira nedostatkom uočljivih preferencija ni za neuređenu ni za kondenzovanu fazu. Umetanje Aβ dovelo je do narušavanja morfologije membrane, posebno do ekspanzije neuređene faze pri niskom GM1 koncentracije i značajan poremećaj kondenziranih domena pri višim GM1 koncentracije. Tokom inkubacije sa POPC vezikulama koje sadrže fiziološke nivoe GM1, povezanost Aβ sa vezikulama je zasijala formiranje Aβ fibrila. Zaključno, povoljne interakcije između Aβ i GM1 u ćelijskoj membrani može obezbijediti mehanizam za Aβ fibrilogenezu in vivo, i Aβ-inducirano oštećenje ćelijske membrane može obezbijediti put kojim Aβ ispoljava toksičnost.

Ovaj rad podržali su Alchajmerovo udruženje (IIRG-9901175) i Američka fondacija za zdravstvenu pomoć (A1999057). Eksperimentalni aparat je omogućio program Nacionalne naučne fondacije za istraživanje instrumentacije i objekata za mlađi fakultet (CHE-9816513). E.Y.C. je podržala Individualna stipendija Nacionalnog instituta za zdravlje Ruth L. Kirschstein (AG025649). S.L.F. je zahvalan na podršci diplomskoj istraživačkoj stipendiji Nacionalne naučne fondacije.

Kome treba uputiti korespondenciju. Telefon: (773) 702-7068. Fax: (773) 702-0805. E-mail: [email protected]


Multimerizacija, nukleacija i taloženje

Sastavljanje Aβ u multimerne strukture ključno je za biološki učinak tih vrsta. Postoje dvije faze sklapanja koje imaju različite karakteristike i dovode do sklopova s ​​različitim biološkim svojstvima. Početni rad sa Aβ fokusirao se na histološke karakteristike AD, amorfne i fibrilarne naslage peptida. Trenutni fokus je na ranijoj fazi sklapanja Aβ koja uključuje rastvorljive multimere peptida. Ove strukture su za redove veličine toksičnije za ćelije različitih tipova od fibrila i izazivaju drugačiji skup toksičnih događaja [90]. Oni su također morfološki i konformacijski različiti. Konformaciona antitijela specifična za oligomer ne prepoznaju monomer ili fibrile, a fibril-specifična antitijela ne prepoznaju rastvorljive oligomere. Iako je potpuno napuštanje uključivanja fibrila u AD u ovom trenutku vjerovatno preuranjeno s obzirom na PIB priču o kojoj se ranije raspravljalo i potencijal za zahvaćenost plaka kod oligomernih populacija [91], fokus polja Aβ se pomjerio na rastvorljive oligomere.

Oligomeri se lako formiraju od Aβ(1-42) peptida, manje od Aβ(1-40) koji je u većoj količini [92]. Postoji bliska korelacija između omjera 42/40 i dobi početka bolesti u porodičnoj AD [93]. C-terminus Aβ(1-42) je kritičan za formiranje oligomera. Bitan et al. [94] definirali su neke od strukturnih parametara za različite korake in vitro sklop oligomera sa sintetičkim peptidima mutiranim u toj regiji. Dok su rani intermedijari tokom oligomerizacije sintetičkog peptida nestabilni i zahtijevaju fotohemijsko hvatanje intermedijara, stabilni mali oligomeri mogu biti izolovani iz bioloških sistema. Objašnjenje ove razlike u stabilnosti nije poznato. Pokazalo se da Aβ oligomeri sa SDS-stabilnim substrukturama kao što su dimeri izolovani iz AD mozga i CSF-a remete sinaptičku elektrofiziologiju [95, 96]. Bilo da ovi međuprodukti nastaju tokom montaže ili nakon demontaže in vivo, ostaje da se utvrdi. Rastvorljivi sintetički Aβ oligomeri su visoko polimorfni sa stabilnim veličinama koje zavise od metode pripreme [97]. Dok se istraživači slažu da su rastvorljivi oligomeri biološki aktivni i mogu izazvati ćelijsku smrt pod nekim uslovima, način delovanja rastvorljivih oligomera takođe ostaje da se utvrdi. Zapaženi su efekti posredovani receptorima [98, 99] kao i direktna aktivnost oligomera na dvosloju membrane, posebno pri visokim (μM) koncentracijama koje mogu proizaći iz njihove površinske aktivnosti. Koncentracija rastvorljivih oligomera u CSF ili moždanoj intersticijskoj tečnosti je u pM opsegu [100].

Formiranje fibrila se proučava pri visokim mikromolarnim koncentracijama monomernog sintetičkog peptida kako bi se povećala vjerovatnoća formiranja jezgra fibrila. Postoje dokazi [101] da formiranje rastvorljivih oligomera i formiranje fibrila mogu biti različiti putevi, iako mehanički oba procesa moraju proći kroz multimerne faze. Budući da su koncentracije Aβ u moždanoj intersticijskoj tekućini najmanje tri reda veličine niže nego u testovima za formiranje fibrila, vjerovatno je da je formiranje fibrila nukleisano na ekstracelularnom matriksu ili na površini ćelija. Rast fibrila proširenjem na sintetičke i AD moždane već postojeće fibrile linearno je ovisan o koncentraciji monomera Aβ [102] i vrlo je specifičan za oblik amiloidnog fibrila [103]. Proces je reverzibilan in vivo u modelima transgenih miševa praćenih multifotonskom mikroskopijom [104] i iznenađujuće je brz u tom sistemu i uključuje vaskularni amiloid [105]. Iako ovaj proces nije dokumentiran u živom ljudskom mozgu, efekti aktivne i pasivne primjene antitijela na životinjskim modelima [106] i pokusima imunizacije ljudi [2] sugeriraju da će depoziti Aβ u mozgu biti u ravnoteži s intersticijalnim Aβ. Postoje i dokazi u skladu s nerastvorljivim Aβ depozitima koji služe kao rezervoar za rastvorljive oligomere [91]. Ne mogu svi skupovi Aβ u ljudskom mozgu učestvovati u ovoj brzoj razmjeni monomera i relativna uključenost različitih grupa u patološki proces je nepoznata.


Metode

Učesnici

Ova studija je bila dio Korejske studije starenja mozga za ranu dijagnozu i predviđanje Alchajmerove bolesti (KBASE), tekuće prospektivne kohortne studije koja je započela 2014. godine. Studija KBASE imala je za cilj tražiti nove biomarkere AD i istražiti kako su višestruka životna iskustva i tjelesne promjene doprinose promjenama na mozgu povezanim s AD. Sadašnja studija analizirala je podatke 414 osoba bez demencije (280 kognitivno normalnih [CN] osoba i 134 osobe sa blagim kognitivnim oštećenjem [MCI]) između 56 i 90 godina starosti (srednja starost 70,9 ± standardna devijacija 7,8 muškaraca, n [%] = 180 [43,5]) koji su regrutovani od 30. novembra 2016. Učesnici su regrutovani preko 4 mjesta za regrutaciju oko Seula, Južna Koreja. Potencijalno kvalifikovane osobe koje su učestvovale u programu skrininga demencije u 2 javna centra za prevenciju i liječenje demencije ili posjetile klinike za pamćenje u 2 univerzitetske bolnice (tj. Nacionalna univerzitetska bolnica u Seulu i SNU-SMG Boramae Medical Center) oko Seula, Južna Koreja, su obaviještene o učešću u studiji, a oni koji su volontirali bili su pozvani na procjenu podobnosti. Osim toga, volonteri iz zajednice su regrutovani putem oglasa na internetu, postera i brošura na glavnim stranicama za regrutaciju, te usmeno (preporučeno od strane drugih učesnika, članova porodice, prijatelja ili poznanika). Detaljnije informacije o karakteristikama KBASE studija, uključujući regrutaciju, objavljene su ranije [35]. CN grupa se sastojala od učesnika sa ocenom kliničke demencije (CDR) [36] 0 i bez dijagnoze MCI ili demencije. Sve osobe sa MCI ispunjavaju trenutne kriterije konsenzusa za amnestičku MCI, a to su: (1) pritužbe na pamćenje koje je potvrdio informator, (2) objektivna oštećenja pamćenja, (3) očuvana globalna kognitivna funkcija, (4) nezavisnost u funkcionalnim aktivnostima i (5) bez demencije. Što se tiče kriterijuma 2, prilagođeno je uzrastu, obrazovanju i polu z-rezultati za najmanje 1 od 4 epizodna testa pamćenja bili su <−1.0. 4 testa pamćenja bili su Memorija liste riječi, Podsjećanje na listu riječi, Prepoznavanje liste riječi i Konstruktivno prisjećanje, koji su uključeni u korejsku verziju Konzorcija za uspostavljanje registra za Alchajmerovu bolest (CERAD-K) bateriju neuropsihološke procjene [37 ]. Sve osobe sa MCI su imale CDR skor od 0,5.

Kriterijumi za isključenje bili su sljedeći: (1) prisustvo ozbiljne psihijatrijske bolesti, uključujući poremećaje povezane s alkoholom (2) značajna neurološka ili medicinska stanja ili komorbiditeti koji bi mogli utjecati na mentalnu funkciju (3) kontraindikacije za MR skeniranje (npr. pejsmejker ili klaustrofobija) (4) nepismenost (5) prisustvo značajnih poteškoća sa vidom/sluhom i/ili teških problema u komunikaciji ili ponašanju koji bi otežali kliničke preglede ili skeniranje mozga (6) uzimanje ispitivanog lijeka i (7) trudnica ili dojenje.

Protokol studije odobrili su institucionalni odbori za reviziju Nacionalne univerzitetske bolnice u Seulu (C-1401-027-547) i SNU-SMG Boramae Medical Center (26-2015-60), Seul, Južna Koreja, a studija je sprovedena u u skladu sa preporukama trenutne verzije Helsinške deklaracije. Učesnici ili njihovi zakonski zastupnici dali su pismeni informirani pristanak.

Kliničke procjene

Svi sudionici su prošli sveobuhvatne kliničke i neuropsihološke procjene koje su dali obučeni psihijatri i neuropsiholozi na osnovu KBASE protokola procjene [35], koji uključuje CERAD-K bateriju neuropsihološke procjene [38,39].

Procjena unosa alkohola

Svi učesnici su sistematski intervjuisani od strane obučenih medicinskih sestara kako bi se utvrdilo unos alkohola koristeći formular za intervju (S1 obrazac za intervju) u zgradi medicinske nauke u medicinskom kampusu Nacionalnog univerziteta u Seulu, Seul, Južna Koreja. Prema smjernicama Svjetske zdravstvene organizacije [40], 1 standardno piće (SD) definirano je kao svako piće koje sadrži 10 grama čistog alkohola. Budući da postoji veliki izbor alkoholnih pića i marki, različita pića su kategorizirana na sljedeći način: 1 limenka piva (4,5% alkohola 330 ml) = 1 SD 1 boca piva (4,5% alkohola 640 ml) = 2 SD, 1 boca lokalnog korejskog žestokog pića (20% alkohola 360 ml) = 6 SD, 1 boca žestokog pića (40% alkohola 750 ml) = 24 SD, 1 boca korejskog tradicionalnog vina (8% alkohola 900 ml) = 6 SD i 1 boca vina (12% alkohola 900 ml) = 9 SD. Dodatno, obrasci uzimanja alkohola za svakog učesnika su kategorizirani na sljedeći način: stanje alkohola (ne-pijač, bivši pijanac, pijanac) i učestalost i količina uzimanja alkohola (SD/dan pijenja, dani pijenja/tjednu, SD/tjedno) tokom prošla godina (trenutna) i životni vijek. Među onima koji piju, oni koji su pili više od 6 SD-a po danu konzumiranja alkohola u protekloj godini bili su podklasifikovani kao osobe koje piju prekomerno [10]. Među sadašnjim osobama koje ne piju, oni koji su redovno pili, ali nisu pili alkohol u protekloj godini su podklasifikovani kao bivši pijanci [5,11]. Prethodne epidemiološke studije o učinku uzimanja alkohola pokazale su da postoji jasna razlika u riziku od ukupne demencije ili AD demencije među grupama koje nisu pile (referenca), ranije su pile, pile blago, umjereno pile i jako su pile [11,22,41 ]. Na osnovu ovih izveštaja, naši učesnici su kategorizovani na osnovu nedeljnog unosa alkohola na sledeći način: ne piju (referentna kategorija), ranije su pili, <1 SD/sedmično (<10 grama/nedeljno blago konzumiranje alkohola), 1–13 SD/nedeljno (10–130). grama/tjedno umjereno pijenje), i 14+ SDs/tjedno (≥140 grama/tjedno nebezbedno pijenje u nedavno revidiranim smjernicama Ministarstva zdravlja Ujedinjenog Kraljevstva [42]).

Procjena potencijalnih zbunjujućih faktora

Na unos alkohola mogu uticati različita druga stanja. Stoga su svi učesnici sistematski procjenjivani o potencijalnim zbunjujućim faktorima, kao što su depresija, vaskularni rizik, tjelesna težina, indeks tjelesne mase (BMI), složenost zanimanja, godišnji prihod i genotipizacija apolipoproteina E (APOE). Za procjenu depresije korištena je skala gerijatrijske depresije (GDS) [43]. Tjelesna težina, visina i stope komorbiditeta vaskularnih faktora rizika (uključujući hipertenziju, dijabetes melitus, dislipidemiju, koronarnu bolest srca, prolazni ishemijski napad i moždani udar) procijenjeni su na osnovu podataka koje su prikupile obučene medicinske sestre tokom sistematskih intervjua učesnika i njihovih informatora BMI izračunata je kao težina u kilogramima podijeljena s kvadratom visine u metrima, a skor vaskularnog rizika izračunat je na osnovu broja faktora vaskularnog rizika [44]. Što se tiče složenosti zanimanja, razmatrali smo samo najduže zanimanje, klasifikovano u 4 nivoa na osnovu nivoa vještina opisanih u Međunarodnoj standardnoj klasifikaciji zanimanja [45]. Zanimanja na nivou vještina 1 obično uključuju jednostavne i rutinske fizičke ili ručne zadatke. Zanimanja na nivou vještina 2 uključuju obavljanje zadataka kao što su rukovanje mašinama i elektronskom opremom, vožnja vozila, održavanje i popravka električne i mehaničke opreme, te manipulacija, naručivanje i skladištenje informacija. Zanimanja na nivou vještina 3 uključuju obavljanje složenih tehničkih i praktičnih zadataka koji zahtijevaju složeno rješavanje problema, rasuđivanje i donošenje odluka u specijalizovanoj oblasti. Zanimanja na nivou vještina 4 uključuju obavljanje zadataka koji zahtijevaju složeno rješavanje problema, donošenje odluka i kreativnost na osnovu obimnog teorijskog i činjeničnog znanja u specijalizovanoj oblasti. Informacije o zanimanju su dobijene iz samoprijave učesnika i potvrđene od pouzdanih informatora. Godišnji prihodi su procijenjeni i kategorizirani u 3 grupe (ispod minimalnih troškova života [MCL], na ili više od MCL, ali ispod dva puta MCL, dvostruko MCL ili više http://www.law.go.kr). MCL je određen prema administrativnom pravilu koje je objavilo Ministarstvo zdravlja i socijalne skrbi Republike Koreje u novembru 2012. MCL je iznosio 572.168 korejskih vona (KRW) (što odgovara US$507,9) za jednočlano domaćinstvo i dodato 286.840 KRW (ekvivalent US$254,6) za svakog dodatnog člana domaćinstva. Uzorci krvi su dobijeni putem venepunkcije, genomska DNK je ekstrahirana iz pune krvi, a APOE genotipizacija je izvedena kao što je prethodno opisano [46]. Pozitivnost apolipoproteina ε4 (APOE4) je kodirana ako je bio prisutan najmanje 1 ε4 alel.

Mjerenje cerebralne depozicije Aβ

Svi sudionici su podvrgnuti simultanim 3D PiB PET i 3D T1-ponderiranim MRI skeniranjem pomoću 3,0T Biograph mMR (PET-MR) skenera (Siemens) u skladu sa smjernicama proizvođača, a detalji o akviziciji PiB PET imidžinga i prethodnoj obradi su dati u S1 metodi. Algoritam automatskog anatomskog obeležavanja i metoda kombinovanja regiona [47] primenjeni su za određivanje regiona od interesa (ROI), za karakterizaciju nivoa zadržavanja PiB u frontalnom, lateralnom parijetalnom, posteriornom cingulatu/prekuneusu i lateralnim temporalnim regionima. Vrijednosti standardiziranog omjera vrijednosti unosa (SUVR) za svaki ROI su izračunate dijeljenjem srednje vrijednosti za sve voksele unutar svakog ROI sa srednjom vrijednošću malog mozga na istoj slici. Globalni kortikalni ROI koji se sastoji od 4 ROI je također definiran, a globalna vrijednost zadržavanja Aβ generirana je dijeljenjem srednje vrijednosti za sve voksele globalnog kortikalnog ROI sa srednjom vrijednošću malog mozga na istoj slici [47,48]. Učesnici su klasifikovani kao Aβ+ ako je globalna retencija Aβ >gt1,21, i kao Aβ− ako je globalna retencija Aβ ≤1,21 [49].

Mjerenje neurodegeneracije AD-signature

Svi učesnici su podvrgnuti FDG PET imidžingu pomoću gore pomenutog PET-MR skenera, a detalji o akviziciji i prethodnoj obradi FDG PET slike dati su u S1 metodi. Određeni su FDG ROI sa AD potpisom, kao što su ugaoni girus, zadnji cingularni korteks i donji temporalni vijuga, koji su osetljivi na promene povezane sa AD [50]. AD-signature cerebralni metabolizam glukoze (AD-CM) definiran je kao srednji SUVR ponderisan po vokselu, ekstrahiran iz AD-signature FDG ROIs, detalji o MRI akviziciji i prethodnoj obradi su dati u S1 metodi. AD-signature kortikalna debljina (AD-CT) je definisana kao srednje vrednosti debljine korteksa dobijene iz AD-signature regiona uključujući entorhinalne, donje temporalne, srednje temporalne i fuziformne girusne regione, kao što je prethodno opisano [50].

Mjerenje WMHs

Svi sudionici su podvrgnuti MR skeniranju sa tečnom atenuiranom inverzionom oporavkom (FLAIR) koristeći gore spomenuti 3.0T PET-MR skener, a detalji mjerenja zapremine cerebralnih WMH su dati u S1 metodi.

Statistička analiza

Kako bismo testirali hipotetičku povezanost između umjerenog unosa alkohola i neuroimaging biomarkera i istražili povezanost između ostalih kategorija unosa alkohola i biomarkera, planirali smo da izvršimo višestruke regresijske analize kako slijedi. Prvo, analize višestruke logističke regresije sa kategorijom unosa alkohola tokom života (ili trenutnom) (tj. bez pijenja, <1 SD/tjedno, 1–13 SD/tjedno i 14+ SDs/tjedno) kao nezavisnom varijablom i Aβ pozitivnošću kao zavisnom sprovedene su varijabilne. U ovim analizama, da bi se uporedio učinak uzimanja alkohola u odnosu na nepijenje, kao referenca je korišteno bez pijenja (tj. bez pijenja u odnosu na <1 SD/tjedno, bez pijenja u odnosu na 1-13 SDs/tjedno, ili bez pijenja u odnosu na 14+ SD/sedmično) unutar svakog modela. Testirana su tri modela, uz postepenu kontrolu potencijalnih zbunjujućih faktora koji bi mogli utjecati na povezanost između unosa alkohola i AD biomarkera. Prvi model (Model 1) nije uključivao nijednu kovarijaciju, drugi model (Model 2) je uključivao dob, spol, APOE4, skor vaskularnog rizika i GDS skor kao kovarijate, a treći model (Model 3) je uključivao kovarijate u drugom modelu plus obrazovanje (srednje obrazovanje ili niže u odnosu na više od srednjeg obrazovanja), klinička dijagnoza (CN naspram MCI), složenost zanimanja, godišnji prihod, tjelesna težina i BMI [51]. Drugo, izvršene su analize višestruke linearne regresije kako bi se uporedile razlike u globalnoj retenciji Aβ, AD-CM, AD-CT i WMH među grupama koje su konzumirale alkohol tokom života (ili trenutnog) uz kontrolu za iste kovarijate. U analizama je korišteno globalno zadržavanje Aβ nakon prirodne log-transformacije kako bi se postigla normalna distribucija.

Kao analize osjetljivosti, također smo izvršili iste analize nakon što smo isključili osobe koje piju prekomjerno opijanje iz životnih ili sadašnjih osoba koje piju kako bismo smanjili utjecaj obrasca prekomjernog pijenja na povezanost između učestalosti i količine uzimanja alkohola i varijabli neuroslika. Osim toga, uradili smo iste analize nakon što smo isključili bivše osobe koje piju iz onih koji sada ne piju kako bismo minimizirali potencijalne efekte prisilno apstinenta koji su prestali koristiti alkohol zbog drugih zdravstvenih problema vezanih za problematično pijenje.

Kako bi se istražio utjecaj dobi (mlađi [<75 godina] naspram starijih [≥75 godina]) [52], spol (žene naspram muškaraca), APOE4 (APOE4+ naspram APOE4-) i klinička dijagnoza (CN naspram MCI)] on the association between alcohol intake and neuroimaging biomarkers that were significant in the analyses described above, the same regression analysis was repeated including a 2-way interaction term between alcohol intake and each of the 4 neuroimaging biomarkers as an additional independent variable.

All statistical analyses were performed using IBM SPSS Statistics 24.


Uvod

Genetic, biochemical, and animal model studies strongly suggest a central role for amyloid-β (Αβ) in the pathogenesis of Alzheimer's disease (AD) (Sisodia, 1999 Golde et al., 2000 St. George-Hyslop, 2000 Selkoe, 2001). Aβ is a 38-43 amino acid peptide derived from the amyloid precursor protein (APP). Early-onset forms of familial, autosomal dominant AD appear to be attributable to an overproduction of a more amyloidogenic form of Aβ (Aβ42), resulting in conversion of Aβ, in early adult life, from soluble, nontoxic forms to both soluble and insoluble toxic forms with a high β-sheet content (Tanzi et al., 1996). In contrast, the most common form of AD (late-onset, age >60) does not appear to result from Aβ overproduction. Instead, other genetic [e.g., APOE (apolipoprotein E) allelic differences] and nongenetic factors appear to be important in determining whether and when Aβ conformational changes occur (Wisniewski et al., 1997 Teplow, 1998 Holtzman, 2001). Thus, understanding not only mechanisms of Aβ production but also factors that control Aβ metabolism are likely to be critical for understanding AD pathogenesis, as well as for developing better diagnostic and treatment methods.

A major pathologic hallmark of AD is the deposition of the normally soluble Aβ peptide into aggregated, extracellular structures called plaques (Price et al., 1998 Selkoe, 2001). Although it is not proven whether the seed, or nidus, of plaques originates extracellularly or intracellularly, recent evidence suggests that initial formation and growth of plaques can occur extracellularly (Meyer-Luehmann et al., 2003). Regardless of where plaques originate, it is likely that the subsequent Aβ building blocks for plaques are derived from the brain interstitial fluid (ISF). Aβ appears to be released from neurons into the extracellular space normally via synaptic activity (Kamenetz et al., 2003). Assessment of the ISF pool of Aβ may provide unique insights into the regulation of Aβ metabolism, Aβ aggregation, and plaque formation. To date, however, there have been no methods that have permitted analysis of ISF Aβ.

To this end, we developed an in vivo microdialysis technique to measure ISF Aβ in awake, APP transgenic mice that develop age-dependent Aβ aggregation and deposition (PDAPP mice) (Games et al., 1995). We compared the steady-state concentrations of several Aβ species in the ISF of 3-month-old and 12- to 15-month-old PDAPP mice to those species within the CSF and tissue. These studies show that the development of Aβ deposition is associated with changes in ISF Aβ levels and ratios that differ in relation to tissue lysates and CSF. By combining our microdialysis technique with a potent γ-secretase inhibitor, we also demonstrate that the half-life of ISF Aβ is short and is markedly influenced by the presence of Aβ deposition. This strongly suggests that rapid inhibition of Aβ production in vivo reveals an equilibrium between soluble and part of the insoluble pool of Aβ. This rapidly dissociable, now measurable pool of Aβ may provide new ways to diagnose the presence of Aβ deposits and is likely to be the target of various anti-Aβ treatments.


Reference

Arriagada PV, Growdon JH, Hedley-Whyte ET, Hyman BT (1992) Neurofibrillary tangles but not senile plaques parallel duration and severity of Alzheimer’s disease. Neurology 42:631–639

Bolmont T, Clavaguera F, Meyer-Luehmann M, Herzig MC, Radde R, Staufenbiel M, Lewis J, Hutton M, Tolnay M, Jucker M (2007) Induction of tau pathology by intracerebral infusion of amyloid-beta -containing brain extract and by amyloid-beta deposition in APP x Tau transgenic mice. Am J Pathol 171:2012–2020

Braak H, Thal DR, Ghebremedhin E, Del Tredici K (2011) Stages of the pathologic process in Alzheimer disease: age categories from 1 to 100 years. J Neuropathol Exp Neurol 70:960–969

Brendza RP, Bacskai BJ, Cirrito JR, Simmons KA, Skoch JM, Klunk WE, Mathis CA, Bales KR, Paul SM, Hyman BT, Holtzman DM (2005) Anti-Abeta antibody treatment promotes the rapid recovery of amyloid-associated neuritic dystrophy in PDAPP transgenic mice. J Clin Invest 115:428–433

Chetelat G (2013) Alzheimer disease: Abeta-independent processes-rethinking preclinical AD. Nat Rev Neurol 9:123–124

de Calignon A, Polydoro M, Suarez-Calvet M, William C, Adamowicz DH, Kopeikina KJ, Pitstick R, Sahara N, Ashe KH, Carlson GA, Spires-Jones TL, Hyman BT (2012) Propagation of tau pathology in a model of early Alzheimer’s disease. Neuron 73:685–697

Geneser-Jensen FA, Blackstad TW (1971) Distribution of acetyl cholinesterase in the hippocampal region of the guinea pig. I. Entorhinal area, parasubiculum, and presubiculum. Z Zellforsch Mikrosk Anat 114:460–481

Gotz J, Chen F, van Dorpe J, Nitsch RM (2001) Formation of neurofibrillary tangles in P301l tau transgenic mice induced by Abeta 42 fibrils. Science 293:1491–1495

Hardy JA, Higgins GA (1992) Alzheimer’s disease: the amyloid cascade hypothesis. Science 256:184–185

Harris JA, Koyama A, Maeda S, Ho K, Devidze N, Dubal DB, Yu GQ, Masliah E, Mucke L (2012) Human P301L-mutant tau expression in mouse entorhinal-hippocampal network causes tau aggregation and presynaptic pathology but no cognitive deficits. PLoS One 7:e45881

Hyman BT, Van Hoesen GW, Damasio AR, Barnes CL (1984) Alzheimer’s disease: cell-specific pathology isolates the hippocampal formation. Science 225:1168–1170

Ingelsson M, Fukumoto H, Newell KL, Growdon JH, Hedley-Whyte ET, Frosch MP, Albert MS, Hyman BT, Irizarry MC (2004) Early Abeta accumulation and progressive synaptic loss, gliosis, and tangle formation in AD brain. Neurology 62:925–931

Jack CR Jr, Knopman DS, Jagust WJ, Petersen RC, Weiner MW, Aisen PS, Shaw LM, Vemuri P, Wiste HJ, Weigand SD, Lesnick TG, Pankratz VS, Donohue MC, Trojanowski JQ (2013) Tracking pathophysiological processes in Alzheimer’s disease: an updated hypothetical model of dynamic biomarkers. Lancet Neurol 12:207–216

Jellinger K, Braak H, Braak E, Fischer P (1991) Alzheimer lesions in the entorhinal region and isocortex in Parkinson’s and Alzheimer’s diseases. Ann N Y Acad Sci 640:203–209

Kovacs GG, Milenkovic I, Wohrer A, Hoftberger R, Gelpi E, Haberler C, Honigschnabl S, Reiner-Concin A, Heinzl H, Jungwirth S, Krampla W, Fischer P, Budka H (2013) Non-Alzheimer neurodegenerative pathologies and their combinations are more frequent than commonly believed in the elderly brain: a community-based autopsy series. Acta Neuropathol 126:365–384

Liu L, Drouet V, Wu JW, Witter MP, Small SA, Clelland C, Duff K (2012) Trans-synaptic spread of tau pathology in vivo. PLoS One 7:e31302

Lynch GS, Lucas PA, Deadwyler SA (1972) The demonstration of acetylcholinesterase containing neurones within the caudate nucleus of the rat. Brain Res 45:617–621

Manaye KF, Wang PC, O’Neil JN, Huang SY, Xu T, Lei DL, Tizabi Y, Ottinger MA, Ingram DK, Mouton PR (2007) Neuropathological quantification of dtg APP/PS1: neuroimaging, stereology, and biochemistry. Age 29:87–96

McKee AC, Kosik KS, Kowall NW (1991) Neuritic pathology and dementia in Alzheimer’s disease. Ann Neurol 30:156–165

Polydoro M, de Calignon A, Suarez-Calvet M, Sanchez L, Kay KR, Nicholls SB, Roe AD, Pitstick R, Carlson GA, Gomez-Isla T, Spires-Jones TL, Hyman BT (2013) Reversal of neurofibrillary tangles and tau-associated phenotype in the rTgTauEC model of early Alzheimer’s disease. J Neurosci 33:13300–13311

Polydoro M, Dzhala VI, Pooler AM, Nicholls SB, McKinney AP, Sanchez L, Pitstick R, Carlson GA, Staley KJ, Spires-Jones TL, Hyman BT (2013) Soluble pathological tau in the entorhinal cortex leads to presynaptic deficits in an early Alzheimer’s disease model. Neuropathol Acta 127:257–270

Pooler AM, Phillips EC, Lau DH, Noble W, Hanger DP (2013) Physiological release of endogenous tau is stimulated by neuronal activity. EMBO Rep 14:389–394

Pooler AM, Polydoro M, Wegmann SK, Pitstick R, Kay KR, Sanchez L, Carlson GA, Gomez-Isla T, Albers MW, Spires-Jones TL, Hyman BT (2013) Tau-amyloid interactions in the rTgTauEC model of early Alzheimer’s disease suggest amyloid-induced disruption of axonal projections and exacerbated axonal pathology. J Comp Neurol 521:4236–4248

Rasool S, Martinez-Coria H, Wu JW, LaFerla F, Glabe CG (2013) Systemic vaccination with anti-oligomeric monoclonal antibodies improves cognitive function by reducing Abeta deposition and tau pathology in 3xTg-AD mice. J Neurochem 126:473–482

Ribe EM, Perez M, Puig B, Gich I, Lim F, Cuadrado M, Sesma T, Catena S, Sanchez B, Nieto M, Gomez-Ramos P, Moran MA, Cabodevilla F, Samaranch L, Ortiz L, Perez A, Ferrer I, Avila J, Gomez-Isla T (2005) Accelerated amyloid deposition, neurofibrillary degeneration and neuronal loss in double mutant APP/tau transgenic mice. Neurobiol Dis 20:814–822

Santacruz K, Lewis J, Spires T, Paulson J, Kotilinek L, Ingelsson M, Guimaraes A, DeTure M, Ramsden M, McGowan E, Forster C, Yue M, Orne J, Janus C, Mariash A, Kuskowski M, Hyman B, Hutton M, Ashe KH (2005) Tau suppression in a neurodegenerative mouse model improves memory function. Science 309:476–481

Thal DR, Rub U, Orantes M, Braak H (2002) Phases of A beta-deposition in the human brain and its relevance for the development of AD. Neurology 58:1791–1800

Wu JW, Herman M, Liu L, Simoes S, Acker CM, Figueroa H, Steinberg JI, Margittai M, Kayed R, Zurzolo C, Di Paolo G, Duff KE (2013) Small misfolded Tau species are internalized via bulk endocytosis and anterogradely and retrogradely transported in neurons. J Biol Chem 288:1856–1870

Yamada K, Holth JK, Liao F, Stewart FR, Mahan TE, Jiang H, Cirrito JR, Patel TK, Hochgrafe K, Mandelkow EM, Holtzman DM (2014) Neuronal activity regulates extracellular tau in vivo. J Exp Med 211:387–393


Pristup dokumentu

  • APA
  • Autor
  • BIBTEX
  • Harvard
  • Standard
  • RIS
  • Vancouver

Research output : Contribution to journal › Review article › peer-review

T1 - In vivo effects of ApoE and clusterin on amyloid-beta metabolism and neuropathology.

N2 - The epsilon4 allele of apolipoprotein E APOE is a risk factor for Alzheimer's disease (AD) and cerebral amyloid angiopathy (CAA), and the epsilon2 allele is associated with a decreased risk for AD. There is strong evidence to suggest that a major, if not the main, mechanism underlying the link between apoE and both AD and CAA is related to the ability of apoE to interact with the amyloid-beta (Abeta) peptide and influence its clearance, aggregation, and conformation. In addition to a number of in vitro studies supporting this concept, in vivo studies with amyloid precursor protein (APP) transgenic mice indicate that apoE and a related molecule, clusterin (also called apolipoprotein J), have profound effects on the onset of Abeta deposition, as well as the local toxicity associated with Abeta deposits both in the brain parenchyma and in cerebral blood vessels. Taken together, these studies suggest that altering the expression of apoE and clusterin in the brain or the interactions between these molecules and Abeta would alter AD pathogenesis and provide new therapeutic avenues for prevention or treatment of CAA and AD.

AB - The epsilon4 allele of apolipoprotein E APOE is a risk factor for Alzheimer's disease (AD) and cerebral amyloid angiopathy (CAA), and the epsilon2 allele is associated with a decreased risk for AD. There is strong evidence to suggest that a major, if not the main, mechanism underlying the link between apoE and both AD and CAA is related to the ability of apoE to interact with the amyloid-beta (Abeta) peptide and influence its clearance, aggregation, and conformation. In addition to a number of in vitro studies supporting this concept, in vivo studies with amyloid precursor protein (APP) transgenic mice indicate that apoE and a related molecule, clusterin (also called apolipoprotein J), have profound effects on the onset of Abeta deposition, as well as the local toxicity associated with Abeta deposits both in the brain parenchyma and in cerebral blood vessels. Taken together, these studies suggest that altering the expression of apoE and clusterin in the brain or the interactions between these molecules and Abeta would alter AD pathogenesis and provide new therapeutic avenues for prevention or treatment of CAA and AD.


MATERIJALI I METODE

Životinje

B6.Cg-Tg(CAG-cre/Esr1)5Amc/J mice, which we referred to as CAG-Cre ERT2 mice, were obtained from The Jackson Laboratory (21). The B6.129S4- Meox2tm1(cre)Sor /J mice, which we referred to as Meox-Cre, were provided by M. Tallquist (24). Tg2576 mice were obtained from Taconic (38). Animals were group-housed in a standard 12-hour light cycle and fed standard mouse chow ad libitum. All animal care protocols were done in accordance with the Institutional Animal Care and Use Committee of the University of Texas Southwestern Medical Center and the University of Freiburg.

In light of the complexity of the genetic crosses and the different origins of the animal strains involved in this study, it has not been possible to conduct all experiments on a strictly homogenous C57Bl/6 strain background. To ensure a minimal effect of strain background on the behavioral results we have found, all animals that were compared were brother/sister crosses that only differ by the absence or presence of Cre recombinase. Moreover, discovering a robust response like the one discussed here in a mixed background, as opposed to an inbred one, further strengthens the validity of the conclusions, rather than diminishing them. It also further supports the applicability of the results to the even more genetically heterogeneous human population.

Generation of the Reln flox/flox miš

To create the targeting vector for the Reelin cKO mouse line, pJB1 [described in (69)] was used as background vector, and murine SV129J embryonic stem (ES) cell DNA was used as template DNA to amplify the short homology arm (SA 1.35 kb), the fragment containing the first exon (EX1 1.25 kb), and the long homology arm (LA 9 kb). To incorporate the first loxP site, a Cla I and a Pvu I restriction site were included in the SA reverse and the EX1 forward primers, respectively. By three-fragment ligation, the (i) SA (cut with Sal I and Cla I) and (ii) EX1 (cut with Sal I and Pvu I) fragments were combined by a (iii) loxP coding linker (two annealed oligos with sticky ends for Cla I and Pvu I) and cloned between the Neo and HSVTK selection marker genes (Xho I site, compatible ends with Sal I) of pJB1. The resulting vector was opened with Not I to insert the 9-kb LA fragment 3′ downstream of the loxP/FRT-flanked neo cassette. The primers used were as follows: SA_forward, 5′- ATCGAT GTCGAC GGAAGTTTTGCTTCTTCCGGTG-3′ (Sal I) SA_reverse, 5′-CA ATCGAT GTTGTTTGTCTACGCCGGCTGCAAC-3′ (Cla I) EX1_forward, 5′-CCTTCTCG CGATCG CGCGTCCTCGCAGAACGGGCAGCC-3′ (Pvu I) EX1_reverse, 5′-GCGGCCGC GTCGAC TGGGCAGCCACCGACCAAAGTGCTC-3′ (Sal I) LA_forward, 5′-TGTT GCGGCCGC GGCGGCCAGTTAAAAGTTCCCGCTG-3′ (Not I) LA_reverse, 5′-GTCGAC GCGGCCGC TTCCATAAAAGGGAAGAGCAAGATG-3′ (Not I). The oligos used were loxP_forward, 5′- CG ATAACTTCGTATAGCATACATTATACGAAGTTAT AT -3′, and loxP_reverse, 5′- CGAT ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGAT -3′.

The final construct containing the SA-loxP-EX1-loxP-Neo-loxP-LA-HSVTK cassette was linearized and electroporated into SV129J ES cells. Gene targeting–positive ES cells [polymerase chain reaction (PCR) screen] were injected into C57Bl/6J blastocysts, resulting in chimeric mice. The chimeras were crossed to C57Bl/6J mice, resulting in Reln fl/wt mice, verified by PCR and Southern blot. Heterozygous animals were backcrossed to Meox-Cre on the BL6 background to yield germline mutant reeler miševi. Heterozygous animals were also backcrossed to CAG- CreERT2 mice to obtain homozygous Reln fl/fl CAG-Cre miševi. These were again backcrossed to Tg2576 mice, and offspring used in the experiments were brother/sister crossed CAG-Cre hemizygous and Tg2576 hemizygous mice. To ensure a minimal effect on the behavioral results we have found, all animals that were compared were brother/sister crosses that differed only by the absence or presence of Cre recombinase.

Tamoxifen injections

At 2 months of age, mice were given daily intraperitoneal injections for 5 days of tamoxifen (135 mg/kg Sigma) dissolved in sunflower oil. Control mice were injected with sunflower oil vehicle.

Antitela

The following primary antibodies were used for the described experiments: NeuN (Millipore, Mab377 1:300), NMDAR2B (Cell Signaling, 4212S 1:2000), NR2A (Cell Signaling, 4205S 1:500), GluR1 (Abcam, ab7260 1:2000), GluR2/3 (Millipore, 07-598 1:2000), β-actin (Abcam, ab8227 1:3000), G10 [(70) 1:1000 for Western blotting, 1:500 for immunohistochemistry], 6E10 (Covance, SIG-39320), 4G8 (Covance, SIG-39220), Dab1 [5091 (71) 1:1000], phospho-GSK3β (Cell Signaling, 9336S 1:3000), GSK3β (BD Transduction, 610201 1:3000), phospho-Tau (Thr 231 ) (Invitrogen, 44746G 1:5000), AT8 (Thermo, #MN1020 1:2000), Tau-5 (Invitrogen, AHB0042 1:5000), phospho-Akt (Ser 473 ) (Cell Signaling, 9271S 1:1000), Akt (Cell Signaling, 9272S 1:1000), phospho-ERK (Cell Signaling, 4370 1:1000), ERK (Cell Signaling, 4696S 1:1000), phospho-Src (Biosource, 44660 1:1000), Src (Biosource, 44-656Z 1:1000), and receptor-associated protein (RAP) (692, 1:1000). Secondary antibodies used were goat anti-mouse Alexa Fluor 488 (Molecular Probes, 1:1000, for immunohistochemistry), donkey anti-rabbit ECL, horseradish peroxidase (HRP)–linked (Amersham, NA934 1:3000), and donkey anti-mouse 800 and donkey anti-rabbit 680 (LI-COR, 1:3000, for Western blotting).

Western blotting

Mice were deeply anesthetized with isoflurane and decapitated, and the hippocampi and cortices were rapidly dissected on ice. Tissues were immediately flash-frozen in liquid nitrogen. The tissue was homogenized in radioimmunoprecipitation assay buffer [50 mM tris (pH 8.0), 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% NP40] with protease and phosphatase inhibitors and then centrifuged at 14,000 rpm for 15 min to remove debris and nuclei. To analyze tau protein, tissues were homogenized in buffer [0.1 M MES (pH 6.8), 0.5 mM MgSO4, 1 mM EGTA, 2 mM dithiothreitol, 0.5 M NaCl, 2 mM phenylmethylsulfonyl fluoride, 20 mM sodium fluoride, 0.5 mM sodium orthovanadate, 1 mM benzamidine, 25 mM β-glycerophosphate, 10 mM str-nitrophenylphosphate, aprotinin (10 μg/ml), leupeptin (10 μg/ml), 1 μM okadaic acid] and then clarified at 14,000 rpm for 5 min at 4°C. The supernatant was boiled for 5 min in a water bath and then put on ice for 5 min the precipitated proteins were removed by centrifugation 14,000 rpm for 5 min. The supernatant was saved for analysis, as previously described (3). Protein concentration was determined using the Bio-Rad DC Protein Assay. Ten micrograms of protein was resolved on 4 to 15% Bio-Rad polyacrylamide gels and then transferred onto nitrocellulose membranes. The membranes were blocked in Odyssey (LI-COR) blocking buffer for 1 hour at room temperature and then incubated overnight in primary antibody. The membranes were protected from light and incubated with 1:3000 Odyssey secondary antibodies and then imaged on the Odyssey CLx Infrared Imaging System. Phosphorylated Src was quantified using ECL secondary antibody and developed using the SuperSignal West Femto Maximum Sensitivity Substrate because of low signal (Life Technologies). Blot quantification was performed using Image Studio software.

Behavioral characterization

All animals were allowed to acclimate in their home cage in the behavior facility for at least 1 hour before experimentation. Experiments were performed between 1400 and 1800. After completion of behavioral studies, Reelin knockout was confirmed by Western blot, and cKO mice that did not show greater than 95% reduction of Reelin in the forebrain were removed from data analysis.

Rotarod

Mice were placed on a Rotamex rotarod apparatus facing away from the experimenter. The rod was initially rotating at 2 rpm and then accelerated at a rate of 1 rpm/5 s until the mice fell off the rod or 300 s had passed. The time to falling off or the first “spin,” when the mouse completed a full rotation holding on to the rod, ended the trial. The mice received four trials per day over the course of 10 days with a 15-min inter-trial interval. The slowest of the four trials was excluded, and the remaining three trials were averaged.

Open field

Mice were individually placed in the center of a VersaMax animal activity monitor, which contained a 42 cm × 42 cm acrylic box with a small layer of bedding. Activity was measured by beam breaks over the course of 60 min in bins of 2 min each. Movement was analyzed using the VersaDat analysis software.

Elevated plus maze

Mice were placed at the center of the elevated plus maze, which consisted of two open arms and two closed arms. Mice were allowed to explore the maze for 5 min, and the time spent in each arm was scored automatically.

Prepulse inhibition

Mice were placed in an SR-LAB startle response system. After 5-min acclimation to a background 70-dB noise, the mice first received five 120-dB tones to record baseline startle. They were then given a series of pseudo-random pairings of a 120-dB tone immediately preceded by a 0-, 74-, 78-, or 86-dB tone. PPI was calculated as the percentage of the average startle at each decibel over the average startle at 0 dB (no tone). After PPI training, mice were tested for startle amplitude over a range of decibels from 70 to 120 dB.

Morris water maze

Mice received a 2-day pretraining before Morris water maze in which they were placed in a small tub (30.5 cm × 61 cm) to find a fixed, hidden platform. They received eight trials per day in which they were given 30 s to find the platform. Mice who did not reach the platform within 10 s for six of eight trials on the second day did not proceed to the Morris water maze. More than 95% of the mice passed the pretraining. For the Morris water maze, mice were placed in a 120-cm-diameter pool that was made opaque with white washable paint. A 10-cm-diameter platform was placed in the center of the northeast (“target”) quadrant of the pool, 1 cm under the surface of the water. Mice were placed in the pool starting in each of the four ordinary (N, S, E, W) directions in a pseudo-random order. A mouse was allowed 60 s to find the platform, and if unsuccessful, they were guided to the platform by the experimenter. After reaching the platform, mice remained there for 5 s before removal from the pool. Four trials happened per day, with a 5-min inter-trial interval. Mice were trained for a total of 10 days. On day 11, the platform was removed for the probe trial, in which the mice swam in the pool for 60 s, and the time spent in each quadrant was recorded. On day 12, the platform was moved to the southeast corner, and its location was made obvious using a flag for the visible probe trial. Mouse movements were recorded and analyzed by the HVS Water software (HVS Image).

Fear conditioning

On day 1, mice were placed in a shock chamber for a 6-min training period, during the last 3 min of which they were exposed to three pairings of a 20-s shock followed by a 2-s 0.6-mA shock. On day 2, mice were placed in the chamber without the tone for 3 min, and the extent of freezing was recorded. Four hours later, mice were placed in a different context for 7 min, and during the last 4 min, they received three exposures to the tone. Mouse freezing was recorded with the FreezeFrame program and analyzed using the FreezeView program (Actimetrics).

Histology and immunohistochemistry

Mice were sacrificed with isoflurane and perfused with 20 ml of ice-cold PBS followed by 20 ml of ice-cold 4% paraformaldehyde (PFA) in PBS. Brains were removed and postfixed in 4% PFA overnight at 4°C. Brains were immobilized in 5% agarose in PBS, and 50-μm-thick sections were sliced on a Leica VT1000 S vibratome. Sections were stored in 0.02% sodium azide in PBS at 4°C. For cresyl violet staining, sections were mounted on charged slides and dried at room temperature overnight. Slides were serially placed in 100% ethanol, 95% ethanol, and double-distilled water, and then stained in 0.1% cresyl violet. Slides were destained in 95% ethanol, then placed in 100% ethanol and xylene, and mounted. NeuN and Reelin immunohistochemistry was done by blocking slices in 3% goat serum for 3 hours at 4°C, then overnight in 1:300 NeuN or 1:500 G10 antibody. Alexa Fluor 594 goat anti-mouse secondary antibody was applied for 2 hours at room temperature, and then hippocampi were imaged at 20× for NeuN. Sequential images of the anti-Reelin sections were acquired using a 10× objective and stitched together using Microsoft Image Composite Editor. For Aβ immunostaining, sections were blocked in 3% H2O2 in methanol for 20 min, followed by 88% formic acid pretreatment for 3 min. The sections were blocked for 2 hours at room temperature with tris-buffered saline (TBS) containing 10% normal horse serum, 2% dl -lysine, 0.25% Triton-X, and a Fab mouse immunoglobulin G (IgG) (H&L) antibody fragment of anti-mouse IgG (1:1000 Rockland Immunochemicals Inc.). Aβ was detected with the antibody 4G8 (1:1000 Covance) followed by incubation with biotinylated anti-mouse IgG secondary antibody. Bound antibodies were visualized by using an ABC (avidin-biotin complex) kit (Vector Laboratories) and a diaminobenzidine kit (Sigma).

Golgi staining

Golgi staining was performed using the FD Rapid GolgiStain Kit (FD Neurotechnologies) according to the manufacturer’s instructions. Slices of 200-μm thickness were obtained with a vibratome (4). Z-sections of the Golgi-stained brains were acquired to measure the spine density of CA1 apical dendrites. Images were zoomed in 4× to measure the height and width of the spines.

Granule cell dispersion

Six serial sections of dorsal hippocampus were taken from each fixed brain and stained with cresyl violet. Images were taken at 20×. The length of the dentate gyrus was divided into 100-μm segments, and at the center of each segment, the width was measured. The average width per animal was taken for each n.

Aβ quantification

Protein extraction from fresh-frozen mouse forebrain (0.4 g) was carried out in 1 ml of 1× TBS containing protease and phosphatase inhibitors. The tissue was homogenized with a micropestle (Eppendorf) followed by sonication. The homogenate was centrifuged for 30 min at 14,000g at 4°C. The supernatant (soluble fraction) was transferred into fresh tubes and kept at −80°C until further use. The remaining pellet was resuspended in 1 ml of PBS containing 1% Triton-X followed by sonication and centrifugation as previously mentioned. For the Aβ ELISA, the tissue was homogenized in PBS and then centrifuged at 14,000 rpm for 25 min at 4°C. The supernatant was reserved (soluble fraction), and the pellet was homogenized in 0.5 M guanidine, allowed to solubilize for 3 hours, and then spun at 14,000 rpm for 25 min (insoluble fraction). A sandwich ELISA was performed using antibodies donated by D. Holtzman. Briefly, Nunc MaxiSorp (Thermo) plates were coated with either HJ2 (anti-Aβ40) or HJ7.4 (anti-Aβ42) and incubated overnight at 4°C. Plates were then incubated with blocking buffer for 1.5 hours. Plates were incubated overnight with the soluble and insoluble tissue samples. The plates were then incubated with HJ5.1-biotin, which recognizes both forms of Aβ. The plates were coated with streptavidin–poly-HRP40 (Pierce) and then developed with Super Slow 3,3′,5,5′-tetramethylbenzidine (Sigma).

Field electrophysiology and θ-burst LTP

θ-Burst LTP was performed as previously described (2). Briefly, mice were deeply anesthetized with isoflurane, and their brains were quickly removed and placed in ice-cold high-sucrose slicing solution (110 mM sucrose, 60 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 28 mM NaHCO3, 0.5 mM CaCl2, 5 mM glucose, 0.6 mM ascorbic acid, 7 mM MgSO4). Transverse slices (350 μm) were cut using a Leica VT1000S vibratome. Slices were allowed to recover in ACSF (124 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 26 mM NaHCO3, 10 mM d -glucose, 2 mM CaCl2, 1 mM MgSO4) for 1 hour at room temperature before the experiments. For recording, slices were transferred to an interface chamber perfused with ACSF at 31°C. Slices were stimulated in the stratum radiatum with concentric bipolar electrodes (FHC) using an isolated pulse stimulator. The stimulus intensity was set to 40 to 60% of the maximum peak amplitude, as determined by measuring the input-output curve. After the baseline stabilized, a θ-burst was applied using a train of four 100-Hz pulses repeated 10 times with 200-ms intervals, and the train was repeated five times at 10-s intervals. The resulting LTP was measured for 1 hour after θ-burst stimulation. Data were analyzed using LabView 7.0.

Statistička analiza

Data were analyzed with GraphPad Prism software (version 6.0, GraphPad Software). Data are shown as means ± SEM, and statistical significance was set at P < 0,05.


Pogledajte video: Инструкция по открытию КТ invivo (Februar 2023).